Hoover High School Mr.Plazaks Biology : Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA.

Slides:

Advertisements

Similar presentations

3 Types of RNA.

Advertisements

RNA and Protein Synthesis

2.7 DNA Replication, transcription and translation

RNA and Protein Synthesis

RNA Ribonucleic Acid.

12-3: RNA AND PROTEIN SYNTHESIS Biology 2. DNA double helix structure explains how DNA can be copied, but not how genes work GENES: sequence of DNA that.

DNA translations/ protein synthesis

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

DNA STRUCTURE page What are the monomers of the nucleic acids?

Transcription and Translation

RNA & Protein Synthesis Chapter 13. DNA A book of instructions that tells each individual what proteins to make for their needs. The path from genes to.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

DNA transcribes to RNA RNA translates to protein.

Transcription and Translation. What is Transcription? It is a process that produces a complementary strand of RNA by copying a complementary strand of.

RNA Ribonucleic Acid. Structure of RNA  Single stranded  Ribose Sugar  5 carbon sugar  Phosphate group  Adenine, Uracil, Cytosine, Guanine.

Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their offspring. How do these genes (made of DNA) turn into.

The Genetic Code.

DNA, RNA and Protein Synthesis. In eukaryotes, genetic information is stored in which organelle? nucleus.

Protein Synthesis: DNA CONTAINS THE GENETIC INFORMATION TO PRODUCE PROTEINS BUT MUST FIRST BE CONVERTED TO RND TO DO SO.

SC.912.L.16.5 Protein Synthesis: Transcription and Translation.

 DNA is the blueprint for life – it contains your genetic information  The order of the bases in a segment of DNA (__________) codes for a particular.

Notes: Protein Synthesis

RNA and Protein Synthesis

12-3 RNA and Protein Synthesis

Protein Synthesis The process of putting together amino acids to form proteins in the cell. The process of putting together amino acids to form proteins.

12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.

FL #24 tRNA’s Role in Protein Synthesis DNA Double Helix Single Stranded RNA.

Protein Synthesis: Transcription & Translation.

DNA, RNA, PROTEIN REVIEW. 1. What are all living things made of? 2. In what organelle is the genetic material located? 3. What is the name of the molecule.

DNA What is the Function of DNA?. Nucleic Acids : Vocab Translation page 183Translation Transcription Protein Synthesis RNA DNA Complementary Introns.

Making of Proteins. DNA Replication DNA molecule produces two new complementary strands. Each strand of the double helix of DNA serves as a template for.

DNA Structure. The Flow of Genetic Information from DNA to RNA to Protein –DNA functions as the inherited directions for a cell or organism. Copyright.

Chapter 12-3: RNA & Protein Synthesis Essential Questions:  What are 3 types of RNA?  What is the function of 3 types of RNA?  What happens during transcription?

8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule.

RNA and Protein Synthesis Chapter How are proteins made? In molecular terms, genes are coded DNA instructions that control the production of.

DNA -> RNA -> Proteins The basic language of all living things.

Transcription & Translation It’s all about making...

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

The Basics of DNA. DNA Deoxyribose sugar Phosphate bonds Nitrogen bases: (A, T, C, and G) A-T and G-C complementary pairing Double stranded (helix) Found.

SC.912.L.16.3 DNA Replication. – During DNA replication, a double-stranded DNA molecule divides into two single strands. New nucleotides bond to each.

Molecular Genetics Transcription & Translation

Biology Unit 4 Notes: RNA & Protein Synthesis

Protein Synthesis.

The making of proteins for …..

RNA and Protein Synthesis

Protein Synthesis.

DNA Test Review.

DNA transcribes RNA RNA translates to protein

RNA Ribonucleic Acid.

Week 6 Vocab Definitions

From Genes to Proteins.

Protein Synthesis PowerPoint

Protein Synthesis Lecture 5

Protein Synthesis.

How genes on a chromosome determine what proteins to make

Protein Synthesis.

Protein Synthesis.

DNA -> RNA -> Proteins

From Genes to Proteins.

RNA, Ribosomes, And Protein synthesis

Protein synthesis.

DNA Transcription and Translation

DNA Replication Living Environment 2015.

Protein Synthesis.

12-3 RNA & Protein Synthesis

Protein Synthesis.

TRANSLATION and MUTATIONS

The Production of Proteins by DNA

Presentation transcript:

Hoover High School Mr.Plazaks Biology

: Write an answer here What is the sequence of an RNA molecule produced from transcription of the following DNA strand: GCCACGT

CGGUGCA

A certain protein is 60 amino acids long. How many nucleotides are required in DNA to code for this protein?

180

What type of molecule is codon is found in?

mRNA

A:B: Write an answer here C:D: Define Translation

The process by wich an mRNA molecule is translated into a protien

A: The genes in the chromosomes of living cells are made of what?

DNA

A:B: Write an answer here The process of reading mRNA and turning it into a polypeptide chain is known as what?

Translation

Give the complimentary DNA sequence of the following DNA: ATCGGTGAACGTAACCATTTAAA

TAGCCACTTGCATTGGTAAATTT

The nucleotide sequence of a DNA codon is GTA. A messenger RNA molecule with a complementary codon is transcribed from the DNA. In the process of protein synthesis, a transfer RNA pairs with the mRNA codon. What is the nucleotide sequence of the tRNA anticodon?

GUA

A:B: Write an answer here Define Mutation?

Changes in the DNA sequence that affect genetic information

Inheritance of acquired characteristics

Great Job!!!! Great Job!!!! Thank you for playing! Thank you for playing!