Ticks and White-tailed Deer in Pennsylvania Jordan J. Grove Methods -Ticks were acquired off of freshly killed deer in local butcher shops during the 2006 rifle deer season. -Only the ears of the deer were sampled to combat collection bias and to be able to sample an adequate number of deer in the time allowed. -The ticks were frozen at -80 degrees Celsius -DNA from the ticks was extracted by crushing the ticks in liquid nitrogen and liberating the DNA by use of chelex and heat. -DNA was probed with LD primers -forward ATGCACACTTGGTGTTAACTA -reverse GACTTATCACCGGCAGTCTTA -The products of PCR were stained and run on an agarose gel -A band at 357 bp was expected for a B.burgdorfei Objectives The objective for this experiment was to identify if a correlation existed between infected ticks and the sex and age of the deer host that they chose. Results -Successful DNA extraction, effective PCR -No significant difference between the age classes of males p- value = Significant difference between males and females at 2.5 years p-value= positive for B. burgdorferi (28ld47 fig.2) -No engorged ticks from the deer tested positive for B. burgdorferi -PCR was run multiple times on 90 sampled ticks Literature Cited Nelson, D.R., Rooney, S., Miller, N.J., Mather, T.J Complement-mediated killing of Borrelia burgdorferi by nonimmune sera from sika deer. Journal of Parasitol 86(6) Carroll J.F Interdigital Gland substances of white-tailed deer and the response of host-seeking ticks. Journal of Medical Entomology 38(1) Carroll J.F., Kramer M Winter activity of Ixodes scapularis and the operation of deer targeted tick control devices in maryland. Journal of Medical Entomology 40(2) Center for Disease Control Statistics on Lyme disease in Pennsylvania. Acknowledgements: I would like to thank Dr. Kaltreider for his help in the lab portion of this study. I would also like to thank Dr. Rehnberg for helping me design the collection portion of this study. They should both be recognized as integral parts of the design and implementation of this study. Introduction -Lyme disease is a bacterial disease caused by the bacteria Borrelia burgdorferi. -B. burgdorferi is carried and transmitted by black- legged deer ticks (Ixodes scapularis) -The ticks are primarily ambush parasites -The adult tick’s main host in the wild is the white- tailed deer (Odocoileus virginianus) -The ticks were shown in a lab setting to have a preference in ambush sites based on scent glands (Carroll 2003) -A preference was shown towards female deer -Recent attempts to control the spread of Lyme disease have targeted white-tailed deer (Carroll and Kramer 2003) -This project was designed to determine if there is a correlation between the sex and age of the deer and the ticks that are feeding on them. -The project also addresses if these ticks are infected with the bacteria and if any identified correlation would translate to infected ticks. 100bp LD47 LD47 LD58 LD 58 28a 28a Ladder 1ul 2ul 1ul 2ul 18s LD47 357bp Figure 2-All LD samples are positive controls. 28a is a positive result for B. burgdorferi in the last lane. Figure 1-Sample size: M0.5 n=2, F0.5 n=1, M1.5 n=6, F1.5 n=1, M2.5 n=6, F2.5 n=6 Discussion -Differences in tick/deer numbers between the 2.5 year old males and females is contradictory to the lab data (Carroll 2001) -Possible reason could be the rut, males traveling more leads to more interaction between them and ambush sites of ticks -No correlation could be made between infected ticks and deer age and sex due to no infected ticks being harvested from the deer -One possible reason could be attributed to a decrease in the prevalence of the disease during Lyme disease incidences went down from 4287 in 2005 to 3242 in 2006 statewide (CDC 2008) -Another reason for this could be the alternative complement reaction in the deer blood killing the B. burgdorferi in the tick midgut before its migration to the saliva -This theory was put forth by Nelson et. al. 2000, and was not refuted by this data -Current method of controlling the spread of Lyme disease may be only targeting ticks that have already been “cleared” of B. burgdorferi -I recommend a study that addresses just Nelson’s theory as this could have an impact on the way we manage the spread of Lyme disease