Microbial Genetics: DNA Replication Gene Expression Lecture 6 Microbial Genetics: DNA Replication Gene Expression

Genetics Genome= Cells genome organized into chromosomes Chromosome= Gene= segment of the DNA that codes for one protein

Bacterial Chromosome Single circular chromosome composed of DNA Looped and folded and attached at one or more points to the plasma membrane Supercoiled

Bacterial Plasmids Many prokaryotic cells also contain plasmids They replicate independently from the chromosome

Nucleic Acids 2 types of nucleic acids: Subunit: Nucleotides Deoxyribonucleic acid (DNA) Ribonucleic acid (RNA) Subunit: Nucleotides 5

Nucleotide 6

Nitrogen containing bases 5 Different: Purines: Adenine (A) Guanine (G) Pyrimadines: Thyamine (T) Cystosine (C) Uracil (U) 7

Synthesis of DNA Dehydration synthesis- forming of covalent bonds between nucleotides Forms between phosphate group of one nucleotide and sugar of another nucleotide Phosphate joins #3 carbon of one sugar with #5 carbon of the other Results in backbone of alternating sugar and phosphate molecules

9

Double Helix of DNA Strand are held together by hydrogen bonds A pairs with T G pairs with C # of A= # of T # of G=# of C DNA sequence: read from 5’ to 3’ Sequence example: ATTAGCA etc. 10

11

DNA Replication

DNA Replication Purpose is to create new DNA strand, so that upon binary fission, each of the 2 cells receives a complete copy of DNA Bidirectional- from distinct starting point- proceeds in both directions Semi- conservative- each of the 2 DNA helix’s generated contains 1 new strand and 1 old strand

First Stage: Initiation DNA unwinds and strands separate As the DNA unzips, two replication forks form and move in opposite directions away from the origin

Second Stage: Elongation Enzymes synthesize a new stand to pair with each original strand Nucleotides can only be added in 3’ to 5’ direction This creates leading and lagging strands The lagging strand is synthesized in Okazaki fragments, which are joined by DNA ligase

Figure 8.4

Third Stage: Termination Two DNA helices separate from each other Each chromosome now contains one old and one new strand

Figure 8.5

Figure 8.6b

Gene Expression: Transcription Translation

Central Dogma of Molecular Biology DNA  RNA  Protein Gene Expression: The production of a protein product from a gene Involves two steps: transcription and translation

Gene Expression Series of two processes that link genes to proteins Transcription: synthesis of RNA from DNA Translation: synthesis of protein from RNA

Transcription DNA used as template Use one strand of DNA to make mRNA molecule mRNA is complementary to one strand of DNA

Initiation of Transcription Transcription begins when RNA polymerase recognizes and binds to sequence of nucleotides in the DNA called the promoter The promoter orients the RNA polymerase in one of two possible directions, telling it which DNA strand to use

Transcription- Elongation RNA polymerase moves along template strand of DNA, synthesizing the complementary single-stranded RNA molecule RNA synthesized in 5’ to 3’ direction, nucleotides added to 3’ end Very fast: 30 nucleotides per second

Transcription- Termination When RNA polymerase encounters terminator it falls off DNA Once terminated RNA is called mRNA

Figure 8.7 (Overview) (1 of 7)

mRNA Messenger RNA Temporary copy of genetic information 3 nucleotides of DNA  3 nucleotides of RNA 3 nucleotides of RNA is a codon One codon codes for one amino acid String of amino acids with proper 3-D shape  protein

Translation Process by which information on mRNA is decoded to synthesize the specified protein Proteins synthesized by adding amino acids sequentially Remember: one codon  one amino acid How many amino acids would one protein contain if it was translated from an mRNA that is 690 nucleotides long?

AUGCGGCAGACCAAACGAUUGGUUGCGUAA How many codons? 10 List the codons: AUG CGG CAG ACC AAA CGA UUG GUU GCG UAA

The Genetic Code: Universal for all living things

Translation Process of translation requires three major components mRNA Ribosomes tRNA

Ribosomes Serve as sites of translation, or sites of protein synthesis Prokaryotic ribosomes are 70S Large subunit- 50S Small subunit- 30S

tRNA Transfer RNA Carries amino acids to the ribosome Recognize and base-pair with a specific codon and deliver appropriate amino acid to site Recognition occurs because each tRNA has an anti-codon, which is complementary to codon on mRNA

Initiation of Translation Translation begins as the mRNA is still being synthesized 30S subunit binds to ribosome-binding site tRNA and 50S subunit soon join AUG- start codon- codes for methionine

Elongation Ribosome moves along mRNA As the next codon is exposed, a new tRNA with correct anti-codon moves in As each tRNA brings in the correct amino acid it forms a covalent bond to it’s neighboring amino acid Elongation continues until stop codon is reached

Regulation of Gene Expression Protein synthesis requires a huge amount of energy Regulation of protein synthesis conserves energy for the cell Repression and Induction Operon model of gene expression

Repression and Induction Repression: inhibits gene expression and decreases the synthesis of enzymes Mediated by regulatory proteins called repressors Induction: process that turns on the transcription of a gene Mediated by regulatory proteins called inducers

Operon model of gene expression Read over Operon Model of Gene Expression before class (page 229-231) Work in groups to understand the concept