Gene Expression. What is Gene Expression?  Expression can be defined as: –Shown –Manifested –Articulated We can determine a person’s genes by what is.

Slides:

Advertisements

Similar presentations

RNA and Protein Synthesis

Advertisements

Do Now:.  TRANSCRIPTION: process that makes an RNA copy of DNA.  RNA is single-stranded, and T is replaced by U (A-U; G-C)  RNA polymerase makes RNA,

CH 11.4 & 11.5 “DNA to Polypeptide”.

What was the most interesting thing that you did over Winter Break? Create a double bubble map comparing/contrasting DNA and RNA.

 Nucleic acid similar to DNA.  Made of sugar ribose.  Generally single stranded.  Instead of thymine, uses uracil (U)

Cell Protein Production

Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 3 Cell Structures and Their Functions Dividing Cells.

 Assemble the DNA  Follow base pair rules  Blue—Guanine  Red—Cytosine  Purple—Thymine  Green--Adenine.

Protein Synthesis.

PROTEIN SYNTHESIS.

Gene Expression Honors Biology.

17.4 – Protein Synthesis and Gene Expression gene expression – the transfer of genetic information from DNA to protein As described.

13.1/13.2 Protein Synthesis From DNA to Protein Protein Synthesis is the process that cells use to produce - it involves.

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

RNA Ribonucleic acid single stranded also made of nucleotides.

Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.

9.1 Transcription. Central Dogma DNARNAPROTEIN TranscriptionTranslation.

Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.

VII RNA and Protein Synthesis

CENTRAL DOGMA OF BIOLOGY. Transcription & Translation How do we make sense of the DNA message? Genotype to Phenotype.

Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis

RNA and Protein Synthesis

Protein synthesis. Why protein synthesis Proteins do almost all of the work in the cell (and organism). Six functions of proteins Control of the number.

SC.912.L.16.5 Protein Synthesis: Transcription and Translation.

Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.

Central Dogma DNA  RNA  Protein. …..Which leads to  Traits.

Protein Synthesis The majority of genes are expressed as the proteins they encode. The process occurs in 2 steps: 1. Transcription (DNA---> RNA) 2. Translation.

Transcription and Translation.  Genes: are segments of DNA that code for proteins  Most nucleotide base sequences in DNA don’t code for anything  ATGCGAATCGTAGCATACGATGCATGCACGTG.

Protein Synthesis Process that makes proteins

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

12-3 RNA and Protein Synthesis

Peptide Bond Formation Walk the Dogma RECALL: The 4 types of organic molecules… CARBOHYDRATES LIPIDS PROTEINS (amino acid chains) NUCLEIC ACIDS (DNA.

12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.

 The central concept in biology is:  DNA determines what protein is made  RNA takes instructions from DNA  RNA programs the production of protein.

Genes and How They Work Chapter The Nature of Genes information flows in one direction: DNA (gene)RNAprotein TranscriptionTranslation.

RNA Another Nucleic Acid.

Do Now: On the “Modeling DNA Transcription & Translation” handout, figure out the compimentary DNA sequence AND the mRNA sequence.

PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.

Binary Code Does it mean anything?

Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.

Review. Questions: What is a single unit of DNA called? Nucleotide What shape is DNA? Double Helix What are the four letters / bases in DNA? A, T, G,

Step One: Transcription

CFE Higher Biology DNA and the Genome Transcription.

Protein Synthesis Traits are determined by proteins (often enzymes) *Protein – 1 or more polypeptide chains *Polypeptide – chain of amino acids linked.

RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.

Gene Expression Honors Biology.

Ch 12-3 Notes, part 2 The Central Dogma = Protein Synthesis.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

DNA to RNA to Protein. RNA Made up of 1. Phosphate 2. Ribose (a sugar) 3. Four bases RNA bases are: Adenine Guanine Cytosine Uracil (instead of thymine)

RNA and Protein Synthesis

Protein synthesis DNA is the genetic code for all life. DNA literally holds the instructions that make all life possible. Even so, DNA does not directly.

Ribosomes and Protein Synthesis

Protein Synthesis (Transcription and Translation)

CENTRAL DOGMA OF BIOLOGY

Protein Synthesis AP Ch 17.

Transcription Part of the message encoded within the sequence of bases in DNA must be transcribed into a sequence of bases in RNA before translation can.

Transcription and Translation

RNA and Protein Synthesis

RNA and Protein Synthesis

Protein Synthesis in Detail

Old News TRANSCRIPTION: process that makes an _______ ___________ of DNA. RNA is ________________, and ___ is replaced by ___ (A-U; G-C) RNA___________________.

Transcription and Translation

Transcription & Translation.

RNA and Protein Synthesis

Cell Protein Production

Transcription Steps to Transcribe DNA:

RNA and Protein Synthesis

Protein Synthesis.

Presentation transcript:

Gene Expression

What is Gene Expression?  Expression can be defined as: –Shown –Manifested –Articulated We can determine a person’s genes by what is shown or seen in their body.

What is Gene Expression?  Genes contain the specific information for our body  They are instructions for making proteins  Proteins make us: –look the way we do –function the way we do –develop and grow the way we do –behave the way we do –think the way we do

What is Gene Expression?  All cells within an organism have the same DNA, but not all genes are expressed. –Example: a neuron (nerve cell) will express genes necessary for nerve function.  Therefore, some genes are active (or expressed) in some cells and some genes are inactivated

How are genes expressed?  With the help of RNA

Making Proteins Step One = Transcription Step Two = Translation

Transcription 1.Initiation: DNA section with desired gene (the yellow strand) is unzipped by RNA polymerase (the green triangle) 2.Elongation: RNA polymerase adds complementary nucleotides, mRNA strand is made (torquoise strand) 3.Termination: when a stop sequence is reached, mRNA separates from DNA and DNA is re-zipped

RNA Processing  Before leaving the nucleus: –1. Introns are removed or spliced - “junk DNA” –2. Exons (“expressed”) are put back together –3. mRNA leaves the nucleus  See page 204 (fig. 8.26) in your text for more info

Codon  3 letter sequence on mRNA  Carries code for amino acid from DNA Anti-codon  3 letter sequence on tRNA  Complimentary to mRNA codon

1.Initiation: Ribosome finds the first codon of the gene on mRNA (It’s ‘AUG’ for every gene!) 2.Elongation: ribosome shifts down to next codon; tRNA brings in next amino acid, repeats 3.Termination: ribosome reaches a “stop” codon, protein is released Translation

Animations  Transcription Transcription  Translation Translation

How does the cell determine what amino acid goes with the mRNA’s codon? CODON = AUG Start in the center and work your way out A U G Amino acid is methionine Try finding the amino acid for the codon ‘CUA’LEUCINE Decoder Chart #1 –

REVIEW MAKE SURE YOU KNOW THE FOLLOWING!  What gene expression means  4 Differences between DNA and RNA  3 Types of RNA and their functions  Codon and Anticodon  How mRNA is processed  Steps of Transcription  Steps of Translation  How to use the ‘decoder chart’(s)