Supplemental Figure S2. TA cloning test of ZeBaTA-based Agrobacterium tumefaciens binary vector. A, TA cloning test of binary vector pCXUN. (1) Ligation of XcmI-digested pCXUN alone yielded very few colonis; (2) Ligation of XcmI-digested pCXUN with PCR product yielded a large number of colonies. The ligations were carried out in a total volume of 10 μL mixture containing 50 ng of T-vector alone, or with the corresponding volume of PCR product of a rice blast fungus Magnaporth oryzea gene MGG_ with a standard insert-to-vector molar ratio around 6:1. The ligation reaction mixture was transformed into E. coli strain DH 10B by electroporation. B, Samples of restriction digestion analysis of the randomly selected colonies derived from ligation of XcmI-digested pCXUN with PCR product of MGG_ All samples (Lanes 1-20) digested by BamHI released one band as expected. A B (1) (2) M

Ubquitin promoter Tnos ccdB gene TGTATGG ACATACC CCATACA GGTATGT XcmI CGCG GCGC ** Ubquitin promoter CGCG GCGC Tnos AAAGAGCGAACATGGTCGACCAGGAGATTCAGTTTGAAGCTGGACTTCACTTTTGCCTCTCTGTCGAGCATCTTCGCTCTTTA ATTTCTCGCTTGTACCAGCTGGTCCTCTAAGTCAAACTTCGACCTGAAGTGAAAACGGAGAGACAGCTCGTAGAAGCGAGAAA OsPDS-amiRNA OsPDS-amiRNA* P1 P2 Ubquitin promoter CGCG GCGC Tnos AAAGAGCGAACATGGTCGACCAGGAGATTCAGTTTGAAGCTGGACTTCACTTTTGCCTCTCTGTCGAGCATCTTCGCTCTTTA ATTTCTCGCTTGTACCAGCTGGTCCTCTAAGTCAAACTTCGACCTGAAGTGAAAACGGAGAGACAGCTCGTAGAAGCGAGAAA OsPDS-amiRNA OsPDS-amiRNA* Introduce the amiRNA/amiRNA* by single-step PCR Making plant expression amiRNA construct by TA cloning Vectors pXUN-osaMIR528 and pCXUN-osaMIR528 Generation of T-vectors by XcmI digestion rice miRNA precursor osa-MIR528, figure modified from Warthmann et al., (2008) Supplemental Figure S3. Schematic representation of single-step PCR generation of an amiRNA construct for gene silencing in rice. Vectors pXUN-osaMIR528 and pCXUN-osaMIR528 were designed based on a rice miRNA precursor osa-MIR528. A G-to-C and a C-to-G mutations (marked with an asterisk) were introduced to generate the XcmI recognition sites. amiRNA and amiRNA* can be introduced into the osa-MIR528 backbone by single step PCR using the primers containing amiRNA/amiRNA* sequence. The system was evaluated by expression of amiRNA for silencing of PDS gene in rice.

Supplemental Figure S4. Predicted Secondary Structure of the Mutated osa-MIR528 stemloop. A, Structure of the original osa-MIR528 stemloop. Structure of the mutated osa-MIR528 stemloop. The secondary structures were predicted using mfold ( The nucleotides marked in the open boxes are the positions where mutations were made to introduce two XcmI recognition sites. AB