Go to Section:

A New Breed The tomatoes in your salad and the dog in your backyard are a result of selective breeding. Over thousands of years, humans have developed breeds of animals and plants that have desirable characteristics. How do breeders predict the results of crossing individuals with different traits? Section 13-1 Interest Grabber

Go to Section: Section 13-1 Interest Grabber continued 1. Think of two very different breeds of dogs that are familiar to you. On a sheet of paper, construct a table that has the following three heads: the name of each of the two dog breeds, and “Cross-Breed. 2.The rows of the table should be labeled with characteristics found in both breeds of dogs. Examples might include size, color, type of coat, intelligence, aggression, and so on. 3.Fill in the column for each of the two dog breeds. In the column labeled “Cross-Breed,” write in the characteristic you would expect to see in a cross between the two breeds you have selected.

Go to Section: Characteristic Dog 1 Dog 2 Cross Breed (Hybrid) Size Color Type of Coat

Go to Section: 13–1Changing the Living World A.Selective Breeding 1.Hybridization 2.Inbreeding B.Increasing Variation 1.Producing New Kinds of Bacteria 2.Producing New Kinds of Plants Section 13-1 Section Outline Go to Section:

Mutations Normal Green-cheek Pair Cinnamon Green-cheek pair, Yellow-sided Green-cheek

Go to Section: which crosses consists of Selective Breeding for example Inbreeding Hybridization Similar organisms Dissimilar organisms for example Organism breed A Organism breed B Retains desired characteristics Combines desired characteristics which which crosses which Section 13-1 Concept Map

Go to Section: Hybridization of two different plants leads to a hybrid with a combination of both parents traits

Go to Section: Hybrids only possible between closely related species Offspring are usually sterile

Go to Section: Mutations Increases variation which is the raw material for selective breeding and evolution Sometimes mutation can be introduced by mutagens like X-rays and chemicals.

Go to Section: Seedless Watermelons are triploid (3N) It is POLYPLOID

Go to Section: The Smallest Scissors in the World Have you ever used your word processor’s Search function? You can specify a sequence of letters, whether it is a sentence, a word, or nonsense, and the program scrolls rapidly through your document, finding every occurrence of that sequence. How might such a function be helpful to a molecular biologist who needs to “search” DNA for the right place to divide it into pieces? Section 13-2 Interest Grabber

Go to Section: 1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find? Section 13-2 Interest Grabber continued

Go to Section: 13–2Manipulating DNA A.The Tools of Molecular Biology 1.DNA Extraction 2.Cutting DNA 3.Separating DNA B.Using the DNA Sequence 1.Reading the Sequence 2.Cutting and Pasting 3.Making Copies Section 13-2 Section Outline

Go to Section:

Restriction enzymes can only fit the DNA at a specific base sequence EX: CTTAAG Animation

Go to Section:

Plasmid Recombinant DNA Ligase seals backbone

Go to Section:

Only some bacteria get a plamid TRANSFORMED Antibiotic added to screen out those without plasmid Only one plasmid has the FROG gene Frog rRNA labelled with radioactive tracer is used to find which plasmid has the frog gene Bacteria with frog gene can now be cloned Penicillin link Genetic Marker

Go to Section: The plasmids are reinserted into the bacteria, but only some take up the plasmid -they must be SCREENED OUT DNA probe (with radioactive tag) complementary to frog gene Animation

Go to Section: Animation of removing introns to put eu gene in prokaryote Cloning Animation

Go to Section: Four Stages in Genetic Engineering 1.Cleaving DNA 2.Producing Recombinant DNA 3.Transforming (and then Cloning Cells) 4.Screening Target Cells with gene 5.(Clone the screened Target cell)

Go to Section: 2. Why does cell division produce bacterial cells that all contain the protein-V gene? When the bacterial cell undergoes cell division, the recombinant plasmid is replicated.

Go to Section: P 365

Go to Section: Plasmid used as a vector

Go to Section: Phage used as a vector

Go to Section:

Ti plasmids in bacteria can cause tumors in plants If the tumor causing gene is removed from the plasmid and a useful gene spliced in - the Ti plasmid can be used as a VECTOR to move genes into plants

Go to Section:

1. How is the Agrobacterium cell used in this process? The Agrobacterium cell is the source of the plasmid into which a new gene is inserted. The recombinant plasmid is then introduced into plant cells.

Go to Section: 2. What is the goal of this process? The goal is to produce plants with desired traits.

Go to Section: Human Cell Gene for human growth hormone Recombinant DNA Gene for human growth hormone Sticky ends DNA recombination DNA insertion Bacterial Cell Plasmid Bacterial chromosome Bacterial cell for containing gene for human growth hormone Section 13-3 Figure 13-9 Making Recombinant DNA

Go to Section: Recombinant plasmid Gene to be transferred Agrobacterium tumefaciens Cellular DNA Transformed bacteria introduce plasmids into plant cells Plant cell colonies Complete plant is generated from transformed cell Inside plant cell, Agrobacterium inserts part of its DNA into host cell chromosome Section 13-3 Figure Plant Cell Transformation

Go to Section: Bt Toxin genetically modifies corn Advantage Kills pests No pesticides sprayed Costs less for insecticide Disadvantage May kill other insects EX pollen may kill passing butterflies and bees Corn seeds cost more

Go to Section: Recombinant DNA Flanking sequences match host Host Cell DNA Target gene Recombinant DNA replaces target gene Modified Host Cell DNA Section 13-3 Knockout Genes Target genes may be inserted into the Host cells DNA if the flanking sequences are the same – theses are called knock out genes.

Go to Section: Geneticists had taken the luciferase gene from a firefly and inserted it into a tobacco plant. This meant that when the plant was fed with luciferin the result was a plant that glows in the dark!

Go to Section:

Plucky is an albino Xenopus laevis frog expressing green fluorescent protein (GFP) in her eye. GFP is a jellyfish protein that fluoresces bright green when illuminated by blue light. GFP is used as a genetic marker to show the appearance of a TRANSGENIC ORGANISM The first cloned mouse was created at UH

Go to Section:

GFP Amino Acids were sequenced Then Bases for DNA were sequenced GFP used as GENETIC MARKER to show that another gene has been inserted

Go to Section: Plant Genome Video

Go to Section: A donor cell is taken from a sheep’s udder. Donor Nucleus These two cells are fused using an electric shock. Fused Cell The fused cell begins dividing normally. Embryo The embryo is placed in the uterus of a foster mother. Foster Mother The embryo develops normally into a lamb—Dolly Cloned Lamb Egg Cell An egg cell is taken from an adult female sheep. The nucleus of the egg cell is removed. Section 13-4 Figure Cloning of the First Mammal

Go to Section:

THE FIRST MOUSE CLONES The clones (two brown mice at bottom) are genetic duplicates of the mouse at top right, which donated its cumulous cells. They are the result of a technique perfected at the University of Hawaii in 1998 Link to Cloning Mimi

Go to Section: WILBUR WANNABES The first litter of cloned pigs, born in 2000 in Virginia, demonstrate that cloning could be used to generate organs for human transplant in the near future

Go to Section: Not to be outdone, Chinese researchers are perfecting cloning techniques in the hope of using the procedure to preserve the country's beloved panda species. For practice, they began with more common species, including goats like Yangyang (above). Cloning remains a tricky process; only 2%-5% of the eggs that start out as clones develop into live animals. The good news is that once they survive past the first year, clones like Yangyang, celebrating her sixth birthday, are relatively healthy.

Go to Section: Dr. Severino Antinori, an Italian embryologist, fires up the press in 2001 after announcing plans to clone the first human to help infertile couples have children. He claimed one of his patients was carrying a clone, but he failed to confirm his tale or produce the child. His comments launched a debate over the ethics of cloning human beings; countries like Britain and South Korea have since made it illegal to clone people, while the U.S. Congress has yet to ban the process.

Go to Section: Link to PCR Animation on Web Animation

Go to Section: DNA polymerase adds complementary strand DNA heated to separate strands DNA fragment to be copied PCR cycles 1 DNA copies etc. 16 etc. Section 13-2 Figure 13-8 PCR

Go to Section: Recognition sequences DNA sequence Section 13-2 Restriction Enzymes

Go to Section: Recognition sequences DNA sequence Restriction enzyme EcoR I cuts the DNA into fragments. Sticky end Section 13-2 Restriction Enzymes

Go to Section: DNA plus restriction enzyme Mixture of DNA fragments Gel Power source Longer fragments Shorter fragments Section 13-2 Figure 13-6 Gel Electrophoresis Gel Electrophoresis simulation

Go to Section: Long fragments Short

Go to Section: P 373 Differences in DNA sequences on homologous chromosomes result in different restriction fragment length patterns RFLP - these may be sorted by length using gel electrophoresis Differences in DNA sequences on homologous chromosomes result in different restriction fragment length patterns RFLP - these may be sorted by length using gel electrophoresis

Go to Section:

Different people have different DNA -DNA when cut by enzymes will leave different size fragments -which will separate into different electrophoresis patterns -a DNA fingerprint Different people have different DNA -DNA when cut by enzymes will leave different size fragments -which will separate into different electrophoresis patterns -a DNA fingerprint Link to DNA Fingerprint Lab Link to DNA Fingerprint Lab If there is only a small sample of DNA available- more copies can be made by PCR - polymerase chain reaction (p371)

Go to Section: A DNA Chip is a microarray of many spots where single stranded DNA is attached – each strand representing a different gene. Single stranded cDNA is made from a target cell’s active mRNA and tagged with a fluorescent dye If a gene is active the dye labeled cDNA will attach and cause that spot to light up when a laser strikes it. This tells you which genes are active. DNA Microarray Identifies Active Genes

Go to Section: Section 13-2 Figure 13-7 DNA Sequencing

Go to Section: Sneaking In You probably have heard of computer viruses. Once inside a computer, these programs follow their original instructions and override instructions already in the host computer. Scientists use small “packages” of DNA to sneak a new gene into a cell, much as a computer virus sneaks into a computer. Section 13-3 Interest Grabber

Go to Section: 1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory? 2.Why would a person download a virus program? 3.If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA? Section 13-3 Interest Grabber continued

Go to Section: 13–3Cell Transformation A.Transforming Bacteria B.Transforming Plant Cells C.Transforming Animal Cells Section 13-3 Section Outline

Go to Section: The Good With the Bad The manipulation of DNA allows scientists to do some interesting things. Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms. Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey. Section 13-4 Interest Grabber

Go to Section: 1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system? 2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild? Section 13-4 Interest Grabber continued

Go to Section: 13–4Applications of Genetic Engineering A.Transgenic Organisms 1.Transgenic Microorganisms 2.Transgenic Animals 3.Transgenic Plants B.Cloning Section 13-4 Section Outline

Go to Section: Cloning Section 13-4 Flowchart A body cell is taken from a donor animal. An egg cell is taken from a donor animal. The fused cell begins dividing, becoming an embryo. The nucleus is removed from the egg. The body cell and egg are fused by electric shock. The embryo is implanted into the uterus of a foster mother. The embryo develops into a cloned animal.

Go to Section: A donor cell is taken from a sheep’s udder. Donor Nucleus These two cells are fused using an electric shock. Fused Cell The fused cell begins dividing normally. Embryo The embryo is placed in the uterus of a foster mother. Foster Mother The embryo develops normally into a lamb—Dolly Cloned Lamb Egg Cell An egg cell is taken from an adult female sheep. The nucleus of the egg cell is removed. Section 13-4 Figure Cloning of the First Mammal

Go to Section: Link to Cloning Mimi

Go to Section:

ADA: The First Gene Therapy Trial A four-year old girl became the first gene therapy patient on September 14, 1990 at the NIH Clinical Center. She has adenosine deaminase (ADA) deficiency, a genetic disease which leaves her defenseless against infections. White blood cells were taken from her, and the normal genes for making adenosine deaminase were inserted into them. The corrected cells were reinjected into her. Dr. W. French Anderson helped develop this landmark clinical trial when he worked at the National Heart, Lung, and Blood InstituteWhite blood cells

Video Click the image to play the video segment. Gene Transfer

Internet Links from the authors on genetically modified foods Interactive test For links on recombinant DNA, go to and enter the Web Code as follows: cbn For links on genetic engineering, go to and enter the Web Code as follows: cbn Go Online

Section 1 Answers Interest Grabber Answers 1. Think of two very different breeds of dogs that are familiar to you. On a sheet of paper, construct a table that has the following three heads: the name of each of the two dog breeds, and “Cross-Breed. Encourage students to refer only to breeds with which they are familiar. 2.The rows of the table should be labeled with characteristics found in both breeds of dogs. Examples might include size, color, type of coat, intelligence, aggression, and so on. Additional traits might include shape of ears, shape of muzzle (pointed or square), or length of legs with respect to body. 3.Fill in the column for each of the two dog breeds. In the column labeled “Cross-Breed,” write in the characteristic you would expect to see in a cross between the two breeds you have selected. Students will likely assume that traits of the cross-breed are intermediate between those of the two parent breeds.

Section 2 Answers Interest Grabber Answers 1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. 1–2: Remind students to check their copies for accuracy before they begin the next step. 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find? Students should find three occurrences of the sequence: GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA

Section 3 Answers Interest Grabber Answers 1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory? A file can be downloaded from a diskette, a CD, or the Internet. 2.Why would a person download a virus program? The computer user would not willingly download a virus but would download a program that was useful. 3.If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA? Possible answers: a useful protein or a strand of DNA that the cell would recognize and accept

Section 4 Answers Interest Grabber Answers 1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system? Students may say that a mouse with a humanlike immune system would be a good laboratory model for immune research. 2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild? Transgenic organisms might disrupt normal balances in ecosystems and could breed with natural populations, changing them.

End of Custom Shows This slide is intentionally blank.