Annotation of Anopheline Genomes at VectorBase Dan Lawson, VectorBase & The Anopheles Genomes Cluster Consortium EMBL-EBI

Anopheline species in this study: Current status Genome sequencing 9 of 16 species assembled and annotated RNAseq 10 of 12 species sequenced Isolate re-sequencing 12 of 12 species sequenced

Genome annotation First-pass genome annotation is almost always based on “automatic” computational approaches ab initio Similarity based Transcript (ESTs, RNAseq) Protein (nr protein database)

Genome annotation First-pass genome annotation is almost always based on “automatic” computational approaches ab initio Similarity based Transcript (ESTs, RNAseq) Protein (nr protein database)

Genome annotation First-pass genome annotation is almost always based on “automatic” computational approaches ab initio Similarity based Transcript (ESTs, RNAseq) Protein (nr protein database)

Genome assembly Map Repeats Genefinding Protein-coding genes Map Transcripts Map Peptides nc-RNAs Functional annotation Submission to archival databases (Release) Genome annotation - building a pipeline

Automatic annotation strategies similarityab initio

Genome annotation: resources ab initio predictions using SNAP and Augustus Mixed whole animal RNAseq datasets generated using Illumina sequencing Assembled using Trinity (Broad Institute) Many dipteran proteomes (including 4 mosquitoes & D. melanogaster) All arthropod/metazoan proteomes

MAKER annotation with RNAseq and reference proteomes Aim: Gene prediction aggregation for the masses. Used for a number of arthropod genome projects Touted as the default pipeline for many more (part of the GMOD toolkit) Overview ab-initio gene predictions from SNAP, Augustus & FGENESH Final gene models from MAKER Similarity alignments from both EXONERATE and BLAST Repeats from RepeatFinder & RepeatMasker Additional data sets integrated via GFF3 files (RNA-Seq) Uses MPI for parallelization over a compute farm Summary Iterative runs give acceptable reference gene sets. Used for Heliconius, Glossina, sandflies and the first tranche of the 16 Anophelines

Current VectorBase annotation pipeline MAKER based automatic annotation includes SNAP training and ab initio RNAseq based transcript similarity prediction Taxonomically constrained peptide similarity prediction 2 rounds of prediction refinement & final round includes all peptide similarity Community annotation phase Capture gene structure changes Metadata associated with locus (symbol, description, citation) Submission to INSDC, propagation to UniProt Presentation through VectorBase Start 1.0 set (automatic) 1.1 set (published)

Projection from a reference annotation

Gene prediction based on projection from reference annotation Local alignment of An. gambiae CDS to the assemblies provide a platform for improving gene predictions. Example loci: Rps7 (AGAP008916) Potential for transcript based assembly improvement via seqedits of genome sequence

Annotation: Preliminary genesets 10, ,162 predictions no ncRNAs yet predicted

Preliminary comparative analysis OrthoMCL runs including 17 species An. gambiae PEST 12,810 protein-coding genes An. darlingi Glossina morsitans Lutzomyia longipalpis Phlebotomus papatasi

Preliminary comparative analysis OrthoMCL runs including 17 species No. of clusters containing all 13 mosquitoes 4961 ( ≃ 39%) An. darlingi Glossina morsitans Lutzomyia longipalpis Phlebotomus papatasi

Preliminary comparative analysis OrthoMCL runs including 17 species No. of clusters containing all 13 mosquitoes 4961 ( ≃ 39%) No. of clusters containing all 11 Anophelines 5463 ( ≃ 43%) An. darlingi Glossina morsitans Lutzomyia longipalpis Phlebotomus papatasi

Preliminary comparative analysis OrthoMCL runs including 17 species No. of clusters containing all 13 mosquitoes 4961 ( ≃ 39%) No. of clusters containing all 11 Anophelines 5463 ( ≃ 43%) No. of clusters containing 10 Anophelines (minus darlingi) 6606 ( ≃ 52%) An. darlingi Glossina morsitans Lutzomyia longipalpis Phlebotomus papatasi

Preliminary comparative analysis OrthoMCL runs including 17 species No. of clusters containing all 13 mosquitoes 4961 ( ≃ 39%) No. of clusters containing all 11 Anophelines 5463 ( ≃ 43%) No. of clusters containing 10 Anophelines (minus darlingi) 6606 ( ≃ 52%) No. of clusters containing 9 Anophelines (minus darlingi & christyi) 7477 ( ≃ 58%) An. darlingi Glossina morsitans Lutzomyia longipalpis Phlebotomus papatasi

Preliminary comparative analysis OrthoMCL runs including 17 species No. of clusters containing all 13 mosquitoes 4961 ( ≃ 39%) No. of clusters containing all 11 Anophelines 5463 ( ≃ 43%) No. of clusters containing 10 Anophelines (minus darlingi) 6606 ( ≃ 52%) No. of clusters containing 9 Anophelines (minus darlingi & christyi) 7477 ( ≃ 58%) No. of clusters containing representatives of the gambiae complex (ar/ga/qu) 9089 ( ≃ 71%) An. darlingi Glossina morsitans Lutzomyia longipalpis Phlebotomus papatasi

Preliminary comparative analysis OrthoMCL runs including 17 species No. of clusters containing all 13 mosquitoes 4961 ( ≃ 39%) No. of clusters containing all 11 Anophelines 5463 ( ≃ 43%) No. of clusters containing 10 Anophelines (minus darlingi) 6606 ( ≃ 52%) No. of clusters containing 9 Anophelines (minus darlingi & christyi) 7477 ( ≃ 58%) No. of clusters containing representatives of the gambiae complex (ar/ga/qu) 9089 ( ≃ 71%) No. of clusters containing 8 Anophelines (- darlingi & christyi) but not gambiae 600 An. darlingi Glossina morsitans Lutzomyia longipalpis Phlebotomus papatasi

All genomes deserves a home Genome browser Similarity searches BLAST/BLAT Query tools Simple keyword Complex queries Downloads Similarity searches Query tool Downloads Browser Compara

VectorBase Long term home for these genomes is VectorBase. NIAID-funded Bioinformatic Resource Center focused on arthropod vectors of human pathogens Ensembl genome browser Similarity searches File downloads

Anopheles Genomes Cluster wiki site

Thematic analysis groups & community annotation Community led annotation of the genomes using the Community Annotation Portal (CAP)

Community annotation decision tree

Community annotation workflow ARTEMIS APOLLO scf ptn2genome ptn_match ID=xxxx;Name=tr|Q3UIQ2| scf ptn2genome ptn_match ID=xxxx2;Name=tr|Q3TIU7| scf ptn2genome ptn_match ID=xxxx3;Name=sp|Q91VD9| scf ptn2genome ptn_match ID=xxxx2;Name=tr|Q3VIU732| scf ptn2genome ptn_match ID=xxxx;Name=tr|Q3UIQ2| scf ptn2genome ptn_match ID=xxxx2;Name=tr|Q3TIU7| scf ptn2genome ptn_match ID=xxxx2;Name=tr|Q3VIU732| >MY SUPERCONTIG ATATATGCGTTGAGCTGCGTTACGTTCGGGATGCGTTAGGCTTGT GAGCTGGATCGGTCCTGCCTGCGTCGATATAAACGACCT… Identify gene Modify model Submit CAP GFF3 FASTA

CAP reporting report back to submitter to show status If successful then the model is stored in a local database and then presented to the genome browser via DAS Failed submissions have (some) information as to why. Submitters then need to correct these errors and re- submit

CAP submissions displayed in the genome browser Similarity track for supporting evidence (from previous updates)

Genome annotation metrics Metrics for quality of a gene set are far from standardised but... Simple statistics (length, number of exons, intron size) Level of support from transcript data (how many genes have overlapping EST/RNAseq) Junction data (confirmation of introns) Comparison to public datasets (UniProt) Protein domains (InterPro) Comparative analysis - orthologs/paralogs

Still to do... Primary annotation Still 7 genomes outstanding from the Broad Institute - de novo repeat finding and MAKER annotation Analysis Whole genome alignments and (12 Drosopholid analysis pipelines from Kellis group - Rob Waterhouse) Data presentation (Trinity clusters, correlation with legacy Hittinger clusters, velvet assembled 37 bp reads) Variation (SNP calls) from each of the 16 species Other genomes New version of the An. darlingi genome (Osvaldo Marinotti, recently published in NAR) New version of the Indian strain of An. stephensi (Jake Tu)

Acknowledgements V EMBL-EBI Imperial College Daniel Lawson, Gareth Maslen, Mikkel Christensen, Nick Langridge, Derek Wilson, Gautier Koscielny, Karyn Megy, Martin Hammond, Daniel Hughes, Ewan Birney, Paul Kersey Fotis Kafatos, Bob MacCallum, George Christophides, Seth Redmond, Timo Tiirikka NoTre Dame HaRvard IMBB New MexicO A Sequencers Ensembl GEnomes Maggie Werner-Washburne Phil Baker Bill Gelbart, Susan Russo, Dave Emmert, Pinglei Zhou, Lynn Crosby, Kathy Campbell Kitsos Louis, Pantelis Topalis, Emmanuel Dialynas, Vicky Dritsou TIGR/JCVI WashU Broad Institute, Baylor College Frank Collins, Greg Madey, Rob Bruggner, Nate Konopinski, EO Stinson, Scott Emrich, Andrew Sheehan, Rory Carmichael, Dave Cieslak, Dave Campbell, Ryan Butler, Katie Cybulski, Neil Lobo, Gloria Calderon, Greg Davis Dan Neafsey, Brian Haas Nora Besansky, Michael Fontaine Michael Nuhn Rob Waterhouse Paul Howell

Contact or

Anopheles Genomes Cluster Consortium Steering committee Community liaisons