Xenograft TDDoxorubicinCisplatinIfosfamide SGDT/C%EfficacySGDT/C%EfficacySGDT/C%Efficacy OHS40.4620.649>37.60++++ CTPX72.910+++1.625++>4.31++++ SBX6,51.728++0.075>22.14++++

Slides:

Advertisements

Similar presentations

Sensitivity of human osteosarcomas to chemotherapy Skjalg Bruheim, Knut Breistøl, Birgitte Smith-Sørensen, Øyvind S Bruland 2, Gunhild M Maelandsmo, Øystein.

Advertisements

Treatment of Relapsed Osteosarcoma After Contemporary Therapy: The Memorial Sloan-Kettering Experience Chou AJ, Merola PR, Vyas Y, Wexler L, Gorlick R,

C.P. Belani 1, T. Brodowicz 2, P. Peterson 3, W. John 3, G. Scagliotti 4 1 Penn State Cancer Institute, Hershey, PA USA; 2 Medical University, Vienna,

Introduction Discussion CT abdomen 3/3/06 lightheadedness and watery diarrhea. TSH was again less than 0.01, and ACTH less than 5. AST and ALT were 240.

Modulation of the Cellular Phenotype in Human Colon Adenocarcinoma Cells by Folic Acid and Polyamine Pools Nathan W. Sweeney, Julie A. Buckmeier, Christina.

Knight et al – Supplementary Table Supplemental Table 1: Cell line Densitometry AROSSIRT1 ARPE WI MCF10A HCT HCT116.

Legends for supplementary figures Fig s1. A: Western blot showing the suppression of SRp20 expression by Dox induction of SRp20 siRNAs in SKOV3 sublines.

P449. p450 Figure 15-1 p451 Figure 15-2 p453 Figure 15-2a p453.

I.1 ii.2 iii.3 iv.4 1+1=. i.1 ii.2 iii.3 iv.4 1+1=

I.1 ii.2 iii.3 iv.4 1+1=. i.1 ii.2 iii.3 iv.4 1+1=

Suppl. Figure 1 A B Suppl. Figure 1. Relative (A) miR-21 and (B) miR-224 expression levels in HCC tumors in different stages (I,II,III,IV) assessed by.

PET after Chemotherapy in Rhabdomyosarcoma Connective Tissue Oncology Society November 19, 2005 Michelle L. Klem, Leonard H. Wexler, Ravinder Grewal, Heiko.

Recent advances in the management of colorectal cancer Vilnius, May 6-7 Epidemiology of colorectal cancer: what we can learn from Lithuania Juozas Kurtinaitis.

Provider of Global Contract Research Services Accelerating Preclinical Research, Drug Discovery & Therapeutics Altogen Labs 4020 S Industrial Dr Suite.

Ct value Log concentration miR-375 miR-221 Supplementary Figure S1.

Pit Pattern Classification in Colonoscopy A short introduction.

NORCCAG audit report 2011: mortality, survival and reconstructive rectal surgery David W Borowski for the members of the Northern Region Colorectal Cancer.

CONFIDENTIAL PillCam ™ COLON PillCam™ COLON has received a CE Mark, but is not cleared for marketing or available for commercial distribution in the USA.

INCIDENCE AND SURVIVAL TRENDS OF COLORECTAL CANCER FROM 2002 TO 2011 BE Ansa; E Alema-Mensah; MD Claridy; JQ Sheats; B Fontenot, and SA Smith Georgia Regents.

Definitive chemo-radiotherapy for esophageal cancer; failure pattern and salvage treatments Ryuta Koike, Y. Nishimura, K. Nakamatsu, S. Kanamori, M. Okubo,

ESP1/SARC025 Global Collaboration: A Phase I Study of a Combination of the PARP inhibitor, Niraparib and Temozolomide in Patients with Previously Treated,

Table S1. Demographics and Patient Pathology Results Total number of patients40 Male (%)29 (72%) Female (%)11 (28%) Age Range47 – 86 Median Age70 Organ.

Supplementary Figures&Legends. Figure1. Subcutaneous xenograft tumor models of the control group.

Supplementary table 1 miR-506 expression and clinocopathological factors FactorsTotal number miR-506 low expressionmiR-506 high expression P-value (n =

The treatment of metastatic squamous cell carcinoma (SCCA) of the anal canal: A single institution experience P. Pathak, B. King, A. Ohinata, P. Das, C.H.

PatientVPA final dose (mg/kg/day) VPA final serum level (mM)(mg/L) Supplemental.

© 2004 by Thomson Delmar Learning, a part of the Thomson Corporation. Fundamentals of Pharmacology for Veterinary Technicians Chapter 20 Antineoplastic.

Fig S1. miR-10b overexpression in exosomes derived from MDA-MB-231 cells stably expressing miR-10b as compared to vector control exosomes. Supplementary.

Differential Diagnoses September 25, You are a psychologist who has been referred 5 cases from the local school district. You have been asked to.

Supplementary Table S1. Patient demographics of the RRBS discovery set. Characteristics RRBS discovery set TotalIDH1/2 WT IDH1 MUT No. of Patients

Supplementary Table S1 Clinical exposure for palbociclib, fulvestrant and chemotherapeutic agents used in this study. Palbociclib (1)*Paclitaxel (2)*Doxorubicin.

Supplemental Figure 1 Expression of UHRF1 detected by TaqMan qRT-PCR and many characteristics of patients were compared by Mann-Whiteney’s U-test. A. Expression.

Table S1. CD44 expression and clinicopathologic characteristics Cases (n=54) CD44 protein expression P value* Negativ e WeakStrong (n=8)(n=23) Age

1 A Randomized, Multi-Center Phase III Trial of Irinotecan in Combination with Three Different Methods of Administration of Fluoropyrimidine with Celecoxib.

Oligo sequence for shRNA cloning TurboGFP shRNA upper strand CCGGCGTGATCTTCACCGACAAGATCTCGAGATCTTGTC GGTGAAGATCACGTTTTT TurboGFP shRNA bottom strand AATTAAAAACGTGATCTTCACCGACAAGATCTCGAGATC.

Supplementary Table 1: Clinicopathologic characteristics of 100 patients with invasive breast cancer Clinical characteristicsNumber of cases (%) Median.

 Cancer  Compound perturbations  Gene perturbations  Tumor development  Cancer metastasis  Cancer treatments Altered Caspase-8 Expression.

Supplementary Figure S1 a

Number of brain metastasis

Supplementary Figure legends 1a-j

Overexpression of CRM1: A Characteristic Feature in a Transformed Phenotype of Lung Carcinogenesis and a Molecular Target for Lung Cancer Adjuvant Therapy

Volume 141, Issue 5, Pages e1 (November 2011)

RADIOLOGICAL ANATOMY OF THE LARGE BOWEL

Outcomes of patients in the North Trent region with advanced non-small-cell lung cancer treated with maintenance pemetrexed following induction with platinum.

Ke Xu, Ph.D. Putuo Hospital and Cancer Institute,

Figure 3. Sensitivity of the gastric carcinoma cell line N87 for trastuzumab in comparison with the breast cancer cell line SKBR-3. (A) Dose–response curves.

Volume 145, Issue 2, Pages (August 2013)

Volume 145, Issue 4, Pages e9 (October 2013)

تهیه کننده: استاد مربوطه: بهار 1392

Fig. S1 PIPKI is highly expressed in cancer cell lines

Volume 141, Issue 5, Pages e1 (November 2011)

Therapeutic Suppression of miR-4261 Attenuates Colorectal Cancer by Targeting MCC Guanming Jiao, Qi Huang, Muren Hu, Xuchun Liang, Fuchen Li, Chunling.

Volume 145, Issue 4, Pages e9 (October 2013)

UHRF1 is regulated by miR-9 in colorectal cancer

Volume 39, Issue 4, Pages (August 2010)

Cytotoxic therapy induces macrophage recruitment, as well as CSF1 and IL-34 mRNA expression. Cytotoxic therapy induces macrophage recruitment, as well.

FLAG β-actin p53 SET M.w. kDa D β-actin p53 G9a

Figure 2S (Supplementary Data)

Volume 145, Issue 2, Pages (August 2013)

Table S1: Characteristics of the cancer patients

miR-124 Inhibits Lung Tumorigenesis Induced by K-ras Mutation and NNK

Chemotherapeutic Drug Combination Index Description

Supplementary Table S2 Correlation between pre-operative plasma miR-451 or miR-486 concentrations and clinicopathologic features in gastric cancer patients.

Activity of MAC-321 (i. v. and p. o

Effect of miRNA mimic on platinum sensitivity.

VC KX-01 Total Src p-Y416 Src Supplementary Figure S1. KX-01 at low dose inhibited phosphorylation of Src in MDA-MB-231 xenografts.

CRA inhibits the growth of human tumor xenografts in vivo.

NSCLC: Staging and TNM classification

Overexpression of CRM1: A Characteristic Feature in a Transformed Phenotype of Lung Carcinogenesis and a Molecular Target for Lung Cancer Adjuvant Therapy

median of follow-up (month)

Presentation transcript:

Xenograft TDDoxorubicinCisplatinIfosfamide SGDT/C%EfficacySGDT/C%EfficacySGDT/C%Efficacy OHS > CTPX > SBX6, > ALSKX AOX TTX GKAMX TPMX TSX pr14, KPDX Supplementary Information Table 1 Table 1. The classification of human osteosarcoma xenografts response to chemotherapeutic drugs Abbreviations: TD, Tumor doubling time; SGD, Specific growth delay; T/C%, Maximal growth inhibition.

Table 2. Expression analysis of miRNAs in osteosarcoma xenografts treated with high dose Doxorubicin, Cisplatin and Ifosfamide Doxorubicin (DOX) Fold change Cisplatin (CPT) Fold Change Ifosfamide (IFO) Fold change hsa-miR hsa-miR-34b29.1hsa-miR hsa-miR-380-5p6.5hsa-miR-17-3p28.8hsa-miR-302a5.3 hsa-miR hsa-miR-302d4.8hsa-miR hsa-miR-99a5.2hsa-miR hsa-miR hsa-miR hsa-miR hsa-miR-526b3.7 hsa-miR hsa-miR-135a3.4hsa-miR hsa-miR hsa-miR hsa-miR hsa-miR-369-5p3.7hsa-miR hsa-miR-30e-5p2.7 hsa-miR-30a-3p3.6hsa-miR-128b2.8hsa-miR-135a2.7 hsa-miR-526b3.5hsa-miR-181c2.6hsa-miR hsa-miR hsa-miR hsa-miR hsa-miR hsa-miR hsa-miR-517a2.5 hsa-miR hsa-miR hsa-miR hsa-miR hsa-miR hsa-miR-92.1 hsa-miR hsa-miR-542-5p2.3hsa-miR-15b2.1 hsa-miR hsa-miR hsa-miR hsa-miR hsa-miR hsa-miR-18a2.0 hsa-miR-221.8hsa-miR hsa-miR-485-5p2.0 hsa-miR-302c0.4hsa-miR hsa-miR hsa-miR hsa-miR hsa-miR-20a1.9 hsa-miR hsa-miR hsa-miR-199b1.9 hsa-miR hsa-miR hsa-miR-90.4hsa-miR-515-3p1.9 hsa-miR-10a0.4hsa-miR-516-3p1.9 hsa-miR-20b0.4hsa-miR hsa-miR-485-5p0.4hsa-miR hsa-miR hsa-miR hsa-miR-517a0.3hsa-miR hsa-miR-515-5p0.2 hsa-miR hsa-miR-18a0.1 Supplementary Information Table 2

CharacteristicsFrequencyPercentage (%) Age (years) Mean (range)62 (30-93) Gender Male Female Anatomic site Ascending colon312.5 Transverse colon28.3 Descending colon416.7 Sigmoid colon312.5 Rectum Histology Adenocarcinoma24100 UICC stage I416.7 II416.7 III833.3 IV833.3 Table 3. Characteristics of the 24 colon cancer patients Supplementary Information Table 3

Supplementary Information Figure p53 -p21 miR control miR-140 U-2 OS MG63 kDa miR control miR  -Tubulin

Supplementary Information Figure 2 ** 0h 24h MTX 0h 24h MTX kDa p53 -  -Tubulin

-HDAC4 -  -Tubulin HCT 116 (wt-p53) vehicle control siRNA control siHDAC kDa a b Supplementary Information Figure 3 HCT 116 (wt-p53)

Supplementary Information Figure 4 P=0.04