A Primer on Genetic Variation Variety Lawrence Brody - NHGRI.

Slides:

Advertisements

Similar presentations

Lecture 2 Strachan and Read Chapter 13

Advertisements

applications of genome sequencing projects

CSC411- Machine Learning and Data Mining Tutorial 10– March 23 th, 2007 University of Toronto (Mississauga Campus)

What is an association study? Define linkage disequilibrium

CZ5225 Methods in Computational Biology Lecture 9: Pharmacogenetics and individual variation of drug response CZ5225 Methods in Computational Biology.

Combinatorial Algorithms for Haplotype Inference Pure Parsimony Dan Gusfield.

Single Nucleotide Polymorphism And Association Studies Stat 115 Dec 12, 2006.

Single Nucleotide Polymorphism Copy Number Variations and SNP Array Xiaole Shirley Liu and Jun Liu.

Our Test Organism Drosophila simulans. Trait of Interest Red vs. White.

Predicting the Function of Single Nucleotide Polymorphisms Corey Harada Advisor: Eleazar Eskin.

From population genetics to variation among species: Computing the rate of fixations.

Computational Tools for Finding and Interpreting Genetic Variations Gabor T. Marth Department of Biology, Boston College

The Extraction of Single Nucleotide Polymorphisms and the Use of Current Sequencing Tools Stephen Tetreault Department of Mathematics and Computer Science.

Something related to genetics? Dr. Lars Eijssen. Bioinformatics to understand studies in genomics – São Paulo – June Image:

Genomewide Association Studies.  1. History –Linkage vs. Association –Power/Sample Size  2. Human Genetic Variation: SNPs  3. Direct vs. Indirect Association.

Polymorphisms – SNP, InDel, Transposon BMI/IBGP 730 Victor Jin, Ph.D. (Slides from Dr. Kun Huang) Department of Biomedical Informatics Ohio State University.

PCR Primer Design

Introduction Basic Genetic Mechanisms Eukaryotic Gene Regulation The Human Genome Project Test 1 Genome I - Genes Genome II – Repetitive DNA Genome III.

Exploring the behavioral genetics of Trade and Cooperation Arcadi Navarro and Elodie Gazave July 5th 2007.

Georgia Wiesner, MD CREC June 20, GATACAATGCATCATATG TATCAGATGCAATATATC ATTGTATCATGTATCATG TATCATGTATCATGTATC ATGTATCATGTCTCCAGA TGCTATGGATCTTATGTA.

1 Genetic Variability. 2 A population is monomorphic at a locus if there exists only one allele at the locus. A population is polymorphic at a locus if.

Mutations Mutation- a change in the DNA nucleotide sequence

Computational research for medical discovery at Boston College Biology Gabor T. Marth Boston College Department of Biology

Microevolution: How Does a Population Evolve? Chapter 16.

EVOLUTION OF POPULATIONS

SNPs Daniel Fernandez Alejandro Quiroz Zárate. A SNP is defined as a single base change in a DNA sequence that occurs in a significant proportion (more.

Gregory Shook. Darwin’s Handicaps Mendel’s work was published but ignored Didn’t know how traits are inherited Didn’t know how variation appeared.

Biology 101 DNA: elegant simplicity A molecule consisting of two strands that wrap around each other to form a “twisted ladder” shape, with the.

CS177 Lecture 10 SNPs and Human Genetic Variation

For natural selection to work – traits must vary Individuals & pop’ns do vary extensively –Beaks of G. fortis –Color spots on guppies Existing variation.

MAPPING GENOMES – genetic, physical & cytological maps Genetic distance (in cM) 1 centimorgan = 1 map unit, corresponding to recombination frequency of.

SNPs and the Human Genome Prof. Sorin Istrail. A SNP is a position in a genome at which two or more different bases occur in the population, each with.

Genome-Wide Association Study (GWAS)

National Taiwan University Department of Computer Science and Information Engineering Pattern Identification in a Haplotype Block * Kun-Mao Chao Department.

What is a SNP?. Lecture topics What is a SNP? What use are they? SNP discovery SNP genotyping Introduction to Linkage Disequilibrium.

Copy Number Variation Eleanor Feingold University of Pittsburgh March 2012.

Polysubstance Abuse–Vulnerability Genes: Genome Scans for Association, Using 1,004 Subjects and 1,494 Single-Nucleotide Polymorphisms Uhl, Liu, Walther,

Genes in human populations n Population genetics: focus on allele frequencies (the “gene pool” = all the gametes in a big pot!) n Hardy-Weinberg calculations.

Julia N. Chapman, Alia Kamal, Archith Ramkumar, Owen L. Astrachan Duke University, Genome Revolution Focus, Department of Computer Science Sources

12-4 Mutations Objective: Contrast gene mutations & chromosomal mutations Are all mutations bad?

Chapter 5 The Content of the Genome 5.1 Introduction genome – The complete set of sequences in the genetic material of an organism. –It includes the.

Using a Single Nucleotide Polymorphism to Predict Bitter Tasting Ability Lab Overview.

Molecular Markers CRITFC Genetics Workshop December 8, 2015.

Mutation & genetic variation. Mutations gene – stretch of dna that codes for a distinctive type of rna or protein allele – versions of the same gene.

Evolution of Populations Chapter 16. The study of genetics helps scientists understand the relationship between inheritance and evolution Scientists know.

Using a Single Nucleotide Polymorphism to Predict Bitter Tasting Ability Lab Overview.

Computational Biology and Genomics at Boston College Biology Gabor T. Marth Department of Biology, Boston College

Evololution Part 1 Genes and Variation Part 1: Genes and Variation.

Objective: What is genetic variation and how does it affect a population?

EVOLUTION Inheritable Variation. Where does variation come from? Remember that inheritable variation comes from mutations and gene shuffling Inheritable.

Evolution of Populations Chapter Genes and Variation How common is genetic variation?

Genetic variation is a difference in DNA tic variation is a difference in DNA.

Pharmacogenetics/Pharmacogenomics. Outline Introduction  Differential drug efficacy  People react differently to drugs Why does drug response vary?

Evolution and Populations –Essential Questions p

The ABC’s of DNA Barry Bowman.

Introduction to bioinformatics lecture 11 SNP by Ms.Shumaila Azam

Genetic Variation Within Populations

Genes and Variations 16:1.

Genes and Variations 16:1.

Do now activity #4 What is the difference between co-dominance and incomplete dominance? What is the difference between a mono-hybrid punnet square.

The role of Genetics and DNA in Evolution (Ch 16.1)

What is allele frequency?

What evidence do we have for evolution? (5)

Objective: Explain the main types of mutations

Academic Biology Notes

Unit 9: Evolution 9.5 Genes and Variation.

SNPs and CNPs By: David Wendel.

The principles of genetic association

A population shares a common gene pool.

Presentation transcript:

A Primer on Genetic Variation Variety Lawrence Brody - NHGRI

Human Genetic Variation What is it? Where did it come from? How is it scored? What use is it?

D. Arbus, 1967

Annie Leibovitz

GATACAATGCATCATATGTA TCAGATGCAATATATCATTG TATCATGTATCATGTATCAT GTATCATGTATCATGTATCA TGTCTCCAGATGCTATGGAT CTTATGTATCATGTATCATGT ATCATGTATGATGTATC

DNA Self Replicating Molecule

Fidelity of DNA replication is nearly perfect Luckily for us, mistakes have been made

Mistakes in DNA The good, the bad and the indifferent

Time (generations) Frequency 100% 0 Fate of New Mutations

Genetic Variation SNP Single Nucleotide Polymorphism Duplications / Deletions

Why SNPs? Numerous Stable Easy to score In genes (sometimes)

GATACAATGCATCATA GATGCAATGTATCATA GATGCTATGCATCATA

Human SNPs 2 chromosomes differ ~1/1,000 bases more chromosomes more sites potential for 30 million variable sites

GATACAATGCATCATA GATGCAATGTATCATA Haplotype

Human Population History relatively young, ~ 100,000 years small populations isolated for long periods of time –estimated “effective breeding pool” - 10,000 individuals explosive expansion coincident with the spread of agriculture

Time (generations) Allele Frequency 1 0 4N e humans = 40,000 generations ~ 1 million years Fate of New Mutations

© 1999 Kenneth K Kidd, Yale University

Human Genetic Variation What is it? Where did it come from? How is it scored?

SNP Genotyping Tools 330, ,000 SNPs per array Affymetrix Illumina Courtesy, S. Gabriel

SNP Chip Image

* * **

When is a variant a polymorphism? Classical definition Two of more alleles Least frequent > 0.01 Functional consequences not relevant Popular definition Mutation = bad! Polymorphism = neutral Frequency not relevant

100,000 years ago Cradle Lands