NAi_transcription_vo1-lg.mov

From Gene to Protein Part 2 Goal 1- Understand the process of transcription How is RNA made? How to get from DNA to RNA Goal 2- Demonstrate how RNA is made Transcription- Model activity

Try This! Molecular Genetics Alphabet Online Activity Crack this code DNA nucleotide triplet ACG Cys Cys

Recap: From Gene to Protein Part 1  What are the two main processes linking gene to protein? “Cookbook” (genotype) “Copy of recipe” “Dish” (phenotype)

The Central Dogma of Molecular Biology replication transcription translation

Why RNA?

Not all genes need to be turned on at once. –We can make an RNA transcript of just ONE GENE –Now we can make the right protein at the right time in the right location

Why RNA? In EUKARYOTES… DNA cannot leave the nucleus BUT proteins are built by the ribosomes in the cytosol! We need a messenger to transfer the genetic code to the ribosomes

mRNA Messenger RNA (mRNA) is a complementary copy of a gene that CAN leave the nucleus

Gaining Access to DNA

4 Phases of Transcription 1.Initiation 2.Elongation 3.Termination 4.Processing (Eukaryotes Only ) To make a copy you need 3 things: 1.Something to copy – DNA! (cookbook) 2.Something to copy with – Nucleotides! (ingredients) 3.Something to make the copy – Enzymes! (recipe)

Initiation (start) DNA template (the “something” to copy) Green fluorescent protein Goal: to express (turn on) DNA nucleotides 3’ 5’

1. DNA template (the something to copy) DNA nucleotides 3’ 5’ 2. RNA nucleotides (the something to copy with) RNA Polymerase II 3. RNA polymerase enzyme (the something to make the copy)

3’ 5’ “TA-TA” box Promoter region Termination sequence Nucleotides (T-T-A-T-T-T) Green fluorescent gene Transcription factor Bind/unwind DNA Transcription unit “Upstream” “Downstream”

Initiation RNA polymerase (RNAP) binds to the double stranded DNA molecule at a promoter sequence (with the help of initiation (transcription) factors) It is able to locally unzip DNA with its own built in helicase activity as it constructs an RNA transcript of the DNA

RNA Polymerase II

Enhancers

Promoters DNA sequence upstream of the gene being transcribed Determines where RNAP binds and where transcription begins Usually rich in Thymine and Adenine (“TATA” box)

Elongation One strand of the unzipped DNA acts as a template for RNA synthesis S G PS A PS T PS C PS G PS G PS A PS C PS C P 3´5´ S G PS G PS T PS C PS C PS G PS A PS T PS C P 3´ Template Strand

Elongation S U P S G PS G PS T PS C PS C PS G PS A PS T PS C P 5´ 3´ Template Strand S C PS G PS A PS T PS C PS G PS G PS A PS C PS C P 3´5´ S A PS G PS C PS C PS U PS G PS G P 3´ Coding Strand

3’ Green fluorescent gene Transcription factor 5’ 3’ 5’ Direction of RNA synthesis 5’3’ Elongation (strand)

Elongation mRNA is transcribed in the 5' to 3' direction DNA unwinds only in the region of transcription After transcription DNA recoils Several RNAPs can work on a single gene at once

One more look at Elongation

Termination A terminator sequence on the coding strand tells RNAP when to stop transcribing the mRNA RNAP is released and reused and mRNA is released

3’ 5’ 3’3’ Termination (stop) Transcription unitTermination sequence messenger RNA (mRNA) Green fluorescent gene Translated Green fluorescent protein Transcribed (copied)

DNA transcription DNA transcription narrated

Transcription Videos mRNA synthesis Stages of Transcription

Processing In Eukaryotic cells the RNA transcript is called pre-mRNA (or primary RNA) because it must still be modified before it leaves the nucleus Why processing? –Remove introns –Protects from degradation in the cytoplasm

Introns and Exons Genes contain both coding regions (exons) and non-coding regions (introns)

Introns and Exons To produce a final mRNA transcript, introns must be removed

Splicing

Splicing The Spliceosome is a complex of multiple proteins (snRNPs) and small nuclear RNA (snRNA) snRNA binds a specific mRNA sequences at the beginning and end of an intron forming a loop The loop is removed and exons are linked

Cap and Tail S G PS G PS U PS C PS C PS G PS A PS U PS C P 5´ 3´ S G PS G P S G PS G P S A PS A P S A PS A P S A PS A P S A PS A P cappoly A tail mRNA transcript

Cap and Tail To protect RNA from restriction endonucleases in the cytosol, a poly-A tail is added to the 3‘ end of the pre-mRNA As an attachment site for the ribosome, a 5‘ cap of modified Gs is added

Try your hand at this: DNA Sequence: TACGGAGCGTTTCCAACGGTGCATATT mRNA Sequence: AUGCCUCGCAAAGGUUGCCACGUAUAA This code will determine the order of amino acids in a protein…

Try it again, with introns! DNA Sequence: INTRONS are red. TACTTGTTATAGTAGTAGGGAGCGCATCTGAA AAAATCGGCATTTCCACTTCTCGAAACCAC CACGGTGCATTCCATT mRNA Primary Transcript: AUGAACAAUAUCAUCAUCCCUCGCGUAGAC UUUUUUAGCCGUAAAGGUGAAGAGCUUUG GUGGUGCCACGUAAGGUAA mRNA Secondary Transcript: AUGAACAAUAUCCGCGUAGACUUUAAAGGU GAAGAGCUUUGGGUAAGGUAA