Evolutionary questions at DUSEL. overview Background: Recent progress in microbial evolution, comparative genomics, community genomics Some examples of.

Slides:



Advertisements
Similar presentations
Recombinant DNA Technology
Advertisements

Chapter 19 Evolutionary Genetics 18 and 20 April, 2004
Cell Structure and Evolutionary History Structure, p. 22.
Phylogenetic Trees Understand the history and diversity of life. Systematics. –Study of biological diversity in evolutionary context. –Phylogeny is evolutionary.
Classification of Living Things. 2 Taxonomy: Distinguishing Species Distinguishing species on the basis of structure can be difficult  Members of the.
Phylogenetic reconstruction
PHYLOGENY AND SYSTEMATICS
Chapter 26 – Phylogeny & the Tree of Life
Review of cladistic technique Shared derived (apomorphic) traits are useful in understanding evolutionary relationships Shared primitive (plesiomorphic)
General Microbiology (Micr300) Lecture 10 Microbial Genetics (Text Chapter: ; )
Protein domains vs. structure domains - an example.
Bioinformatics Student host Chris Johnston Speaker Dr Kate McCain.
Central Dogma Information storage in biological molecules DNA RNA Protein transcription translation replication.
Brock Biology of Microorganisms
Cloning:Recombinant DNA
The Microbiome and Metagenomics
Scientific FieldsScientific Fields  Different fields of science have contributed evidence for the theory of evolution  Anatomy  Embryology  Biochemistry.
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
Zoology Zoon = animal Logos = study of Zoology = study of animals
Plant of the Day! Rafflesia arnoldii (Euphorbiaceae)
Unit 1: The Language of Science  communicate and apply scientific information extracted from various sources (3.B)  evaluate models according to their.
Topic 6 Growth & Reproduction of Bacteria
Microbial taxonomy and phylogeny
Molecular Microbial Ecology
Molecular phylogenetics
CSE 6406: Bioinformatics Algorithms. Course Outline
Beyond the Human Genome Project Future goals and projects based on findings from the HGP.
The Evolutionary History of Biodiversity
Probes can be designed in an evolutionary hierarchy.
Microbial Genetics. Your Cousin The Banana Genome of a Mycoplasma.
Ch 10 Classification of Microorganisms.
Library screening Heterologous and homologous gene probes Differential screening Expression library screening.
Bioinformatics 2011 Molecular Evolution Revised 29/12/06.
Microbial Models I: Genetics of Viruses and Bacteria 7 November, 2005 Text Chapter 18.
Phylogenetic Trees: Common Ancestry and Divergence 1B1: Organisms share many conserved core processes and features that evolved and are widely distributed.
Prokaryotes Lack nucleus No organelles Possess DNA, RNA, and all other machinery Possess ATP synthesis Two Domains –Bacteria –Archaea.
RECONSTRUCTING A “UNIVERSAL TREE” Classical view Prokaryotes Eukaryotes 1977: C. Woese 3 “primordial kingdoms” (or domains) - based on ribosomal RNA sequence.
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
Prokaryotes Chapter 20. Figure 5.1 The Scale of Life.
Microbial genomics Genomics: study of entire genomes Logical next step after genetics: study of genes Genomics: 1) “Structural genomics” * Determine and.
Chapter 24: Molecular and Genomic Evolution CHAPTER 24 Molecular and Genomic Evolution.
Chapter 10 Prokaryotic Genetics.
Classification.
Microbial Genetics. DNA is the Genetic Material Griffiths Avery et al.
Microbial Models I: Genetics of Viruses and Bacteria 8 November, 2004 Text Chapter 18.
Chap 18 The Genetics of Viruses and Bacteria. Structure of Virus Approximately 20 nm in diameter Their genome can contain DNA or RNA. Enclosed by a.
{ Early Earth and the Origin of Life Chapter 15.  The Earth formed 4.6 billion years ago  Earliest evidence for life on Earth  Comes from 3.5 billion-year-old.
Chapter 26 Phylogeny and Systematics. Tree of Life Phylogeny – evolutionary history of a species or group - draw information from fossil record - organisms.
TOPIC 7- EVIDENCE FOR THE THEORY OF EVOLUTION DAY 1.
Molecular Clocks and Continued Research
Evolution: rate of evolution CfE Advanced Higher Biology Unit 2: Organisms and Evolution.
VECTORS: TYPES AND CHARACTERISTICS
Microbial Genetics.
Biology Test Content ETS Major Field Test – 150 Questions.
General Microbiology (Micr300)
De novo creation of new genes 1.Retrotransposition (+/- cooption of other sequences) AAAAA Pre-mRNA AAAAA Splicing to remove intron Reverse transcription.
Metagenomic Species Diversity.
E.Coli AS MODERN VECTOR.
The process of evolution drives the diversity and unity of life
Microbial Genetics Eukaryotic microbes: fungi, yeasts Eukaryotic genome Chromosomal DNA Mitochondrial DNA Plasmids in yeast Prokaryotic.
Virus Basics - part I Viruses are genetic parasites that are smaller than living cells. They are much more complex than molecules, but clearly not alive,
Molecular Phylogeny Similarity among organisms (and their genes) is the result of descent from a common ancestor. Variation occurs via genetic drift and.
Pipelines for Computational Analysis (Bioinformatics)
Workshop on the analysis of microbial sequence data using ARB
Gene Transfer, Genetic Engineering, and Genomics
Unit Genomic sequencing
AS Level Paper 1 and 2. A2 Level Paper 1 and 3 - Topics 1-4
Essential knowledge 1.B.1:
E.Coli AS MODERN VECTOR.
Genetics of Microbial Biodegradation
Presentation transcript:

Evolutionary questions at DUSEL

overview Background: Recent progress in microbial evolution, comparative genomics, community genomics Some examples of broad questions that might be addressed at DUSEL –General indications of approaches Linkages –Databases, other initiatives

Evolution of approaches to prokaryotic diversity Presequencing era: bacterial species characterized on the basis of biochemical properties (stains/metabolism) Early days of RNA sequencing: revolutionized views of bacterial relationships and gave basis for current view of universal tree of life (Carl Woese, 1980s) –Recognition of the Archaea as distinct group –Previously recognized higher taxa completely reorganized –Small genome bacteria recognized as derived rather than primitive (Mycoplasmas/Mollicutes, Rickettsia) –confirms symbiotic origin of mitochondria and chloroplasts Largescale small subunit rDNA sequencing using PCR, (Ribosomal database project, improved coverage and accuracy of the universal tree) Sequence-based approaches to microbial diversity (1990s) –Sequence-based diversity inventories –In situ hybridization of rRNA to relate sequence to distribution Comparative Genomics: finding of massive movement of novel genes into lineages of organisms over evolutionary time, development of advanced methods for recognizing functional homology Community genomics / “meta-genomics” : merging genomics and inferences about functional properties with evolutionary and ecological framework

Microbial communities from diverse environments Hyperdiverse Most (~99%) cannot be readily cultured “great plate count anomaly” –Molecular sequence surveys reveal much more diversity among taxa than found from culturing from the same environmental sources

Full genome sequences now available for most major groups Numbers growing quickly

Environmental genomics Eg.: Tyson et al. Nature Community structure and metabolism through reconstruction of microbial genomes from the environment. Large scale sequencing from pink biofilm in acid mine drainage: Simple community Dominated by Leptospirillum (Bacteria, yellow) & Ferroplasma (Archaea -purple) Probes specific to determined DNA sequences

Microbial evolutionary genomics 1st genome sequenced in 1994, hundreds now complete and public, thousands in the near future. Broad questions that are now being addressed: –How do genomes acquire their contents, as lineages evolve over long time scales? –What are the forces that enable complex biological processes to be maintained? –How do genes (and their associated functions) originate in genomes and how are they lost? –How do biological capabilities move from one organism to another and how do they persist over space and time?

Mechanisms and consequences of Lateral Gene Transfer Redfield, Nat. Rev. Genet ABC Organismal phylogeny ABC gene phylogeny Transduction: via a virus (bacteriophage) Transformation: integration of free DNA Conjugation: direct contact (plasmid)

Most genes in most genomes arrived via LGT after the common ancestor. Most genes arriving via LGT come from distant sources (not in this group) Many persist as vertically transmitted genes within the descendant clade. ---but many are lost quickly (many present only in tips of tree) Gene uptake In gamma- Proteobacteria E. Lerat et al 03 Example of genome dynamics over time due to Lateral Gene Transfer

Evolutionary and ecological genomics underground: Questions first, logistics later Imagine obtaining complete genomes for whole communities of organisms in deep subsurface communities And the phage as well What questions could be addressed?

Evolutionary questions 1. Do deep organisms consist of recent twigs on the Tree of Life that is already well sampled on the surface or do they include ancient branches with clues to the earliest organisms on Earth? 2. Do subsurface organisms show distinctive genome dynamics, such as lack of gene uptake due to low densities? Do they comprise a gene reservoir that exchanges genes with surface organisms? 3. Do subsurface organisms show distinctive mutational profiles, as expected from their distinct mutagenic environment? Do they show fast evolution of polypeptide sequences, reflecting small genetic population sizes/spatial substructuring? 4. What are unusual adaptations, such as mechanisms for responding to unusual kinds of stress, using different energy sources, etc? Can they provide us with novel sources of genes that can be harnessed for practical uses? For each question, answers are likely to depend on the particular niche and may differ among microbial communities associated with different processes or sites.

1. Do deep organisms consist of recent twigs on the Tree of Life that is already well sampled on the surface or do they include ancient branches with clues to the earliest organisms on Earth? Approaches –Phylogenetics Models of sequence evolution provides a statistical basis for inferring relationships and ancestral sequences –Molecular clocks and “coalescent” approaches: allows age of divergence to be calculated in units of generation times and population sizes. Based in “Neutral Theory” of molecular evolution

2. Do subsurface organisms show distinctive genome dynamics, such as lack of gene uptake due to low densities? Do they comprise a gene reservoir that exchanges genes with surface organisms? Approaches: genomic sequencing, comparative analyses with growing genomic databases, phylogenetics. Comparisons of genomes from organisms isolated from sites with similar and different geochemical features.

Factors enabling smaller genome sizes in bacteria –Genetic drift (genes are inactivated through mildly deleterious mutations and are then lost) (eg symbionts and pathogens with small effective population sizes) –Parasitism (genes are not needed because hosts provide gene products) (eg pathogens such as mycoplasmas) –Environmental constancy (eg Prochlorococcus, symbionts) no need for different genes for different conditions, no need for signalling mechanisms –Lack of intense biowarfae in dense complex communties: eg soil microbes sometimes have quite large genomes with size augmented by genes for making bacteriocins, antibiotics (eg Streptomyces and others). –Selection for efficiency? (small genomes are more competitive in replication race) (eg possibly low-light adapted Prochlorococcus marine photoautotrophs).

What is the role of phage in dynamics of subsurface genomes? Do phage move genes from the deep subsurface to surface communities? –Much evidence for phage-mediated gene movement among diverse lineages and environments in surface communities. –As a set, phage contain the largest diversity of gene types –Phage genes can be considered as bacterial genes in transit But are phage rare in subsurface communities due to low host densities? –These genomes may be uniquely deprived of gene uptake and recombination more generally Approaches: can sample phage directly and also search bacterial chromosomes for phage indicator genes.

3. Do subsurface organisms show distinctive mutational profiles, as expected from their distinct mutagenic environment? Do they show fast evolution of polypeptide sequences, reflecting small genetic population sizes/spatial substructuring?

gene sequence evolution in the deep Deep organisms expected to have unusual mutational patterns and unusual patterns of fixation of mutations in populations, both affecting gene evolution Expectations for Mutation rates –Lack of uv irradiation –Other mutagens present--Chemical, heat-dependent –Long generation time some mutational events are dependent on replication and will be proportional to generation time not absolute time; other mutations result from DNA damage between replication events, such as during transcription. –Repair processes differ among organisms with some having more complete sets of repair pathways than others. Organisms with small genomes tend to have fewer repair pathways and may suffer effectively higher rates of mutation. Expectations for fixation of mutations in populations –at sites under purifying selection (most sites in most genes) –From Neutral Theory and much empirical data: small genetic population sizes and/or low rates of genetic recombination impose more rapid rates of protein evolution, resulting from inability to purge mildly deleterious mutations.

Approaches: genomic sequencing, comparative analyses with growing genomic databases, phylogenetics. Comparisons of genomes from organisms isolated from sites with similar and different geochemical features. Many kinds of analyses are designed to distinguish changes in mutation rates from changes in substitution patterns 3. Do subsurface organisms show distinctive mutational profiles, as expected from their distinct mutagenic environment? Do they show fast evolution of polypeptide sequences, reflecting small genetic population sizes/spatial substructuring?

--> Amount of sequence evolution--> Deep Surface Do gene sequences of subsurface organisms evolve at faster or slower rates than those of surface organisms? Address by using sequences obtained from modern organisms, reconstruct phylogenetic relationships, ancestral sequences, and relative lengths of branches ?

4. What are unusual adaptations, such as mechanisms for responding to unusual kinds of stress, using different energy sources, etc? Can they provide us with novel sources of genes that can be harnessed for practical uses? Approaches: “meta-genomics” analyses of organisms -- can be associated with geochemical processes measured in situ Systems biology: how do individual processes mediated by different organisms lead to net effects of microbial communities on their surroundings? Processes and products useful in bioremediation, industrial applications, pharmaceuticals

“meta-genomics” Obtaining gene sequences directly from environmental samples of DNA, no cultivation or characterization of individual species Two goals –Discovery of novel biocatalyst genes for applications –Understanding of microbial community diversity –Understanding of basic cell processes (“systems biology” approaches in particular)

1. Extract DNA from environmental sample 2. Construct library conventional small insert (<10kb) library large insert (cosmid or BAC) library (up to 200 kb), allows sampling of whole operons Possible problems with efficient transcription of the cloned fragment, translation, secretion of the product, correct chaperones for folding of the product Perform functional screens: directly test for some biochemical property in the cloning host Sequence DNA or RNA, look for genes with functions of interest 3. Screen Limits search to genes with detectable (evolutionary) homology to functionally characterized genes: Sequence or structural homology Limitations: Two basic metagenomic approaches

Metabolic inferences Example from Tyson et al study (acid mine community) e.g., Infer N fixation In Leptospirillum Group III, Ferroplasma must Use N fixed by Lepto. Gr III

Example from marine bacteria PCR-based approaches have revealed that 99% of marine microbes cannot be readily cultured in the lab. Gene sequencing from marine DNA has revealed undiscovered genes that imply new metabolic strategies: Proteorhodopsin = rhodopsin-based photosynthesis in bacteria located on a 130 kb BAC recognized based on similarity to archaeal rhodopsins (same basic structure as animal eye opsins ) Expressed in E. coli (red) structure Bacterial Rhodopsin: Evidence for a New Type of Phototrophy in the Sea Beja et al. Science 2000

Well developed tools and databases for genomics data of microbes (NIH-NCBI, DOE, others). Cyber Infrastructure for Tree of Life Initiative (NSF) –network and research project to develop software and databases for phylogenetic information –$11.6 million over 5 years –Central aim is to establish Universal Tree of all Life using biological data, esp. DNA sequence data –Large component concerns whole genome evolution –PI Bernard Moret (Computer Science, U New Mexico), plus large team at 13 institutions, hosted by SD supercomputing network. Evolutionary Synthesis Center (NSF) –NSF sponsored center, recently awarded to Research Triangle institutions, emphasis on interdisciplinary research on evolution, analysis of large datasets, education and outreach Others Linkages of Evolutionary questions at DUSEL with other large scale initiatives