Genomes & their evolution Campbell & Reece Chapter 21

Genomics study of a specie’s whole set of genes & their interactions bioinformatics: use of computers, software, & mathematical modes to process & integrate biological informationfrom large data sets

Human Genome Project sequencing the human genome 1990 – 2003 20 large centers in 6 countries + many other small labs working on small parts of it

FISH Cytogenetic Map: chromosome banding pattern & location of specific genes by flourescence in situ hybridization (FISH) b/4 Human Genome Project the # of chromosomes & their banding patterns known for many species some human genes already located

FISH method in which flourescently labeled nucleic acid probes allowed to hybridize to immobilized array of whole chromosomes maps generated from this used as starting point

3 Stages to Genome Sequencing Linkage Mapping Physical Mapping DNA Sequencing

Linkage Mapping ordering of genetic markers (1000’s) spaced thru-out chromosomes order & spacing determined by recombinant frequencies markers: genes, RFLPs, (restriction fragment length polymorphism) or STRs (short tandem repeats)

RFLP in gel electrophoresis, fragments of DNA are separated by length (-) charge of phosphate groups moves DNA thru gel (acting like a sieve) toward (+) end resulting in: bands that each consist of thousands of DNA molecules of same length

RFLP 1 useful technique has been to apply restriction fragment analysis to these bands  information about DNA sequences restriction enzymes “cut” DNA at known nucleotide sequences then these fragments produced are put thru gel electrophoresis

RFLP DNA can be recovered undamaged from gel bands (so can be used to prepare pure sample of individual fragments) can be used to compare 2 different DNA molecules (2 alleles of same gene) if nucleotide sequence affects a restriction site: change in even 1 nucleotide will prevent the “cut”

RFLP (restriction fragment length polymorphism) polymorphisms: variations in DNA sequence among a population this particular type of sequence change is called RFLP (“rif-lip”) if 1 allele contains a RFLP, digestion with the enzyme will produce a fragment of different length

Short Tandem Repeats: STR technique used by forensic scientists are tandemly repeated units of 2 to 5 base sequences in specific regions of the genome # repeats present is highly variable person to person (polymorphic) 1 individual’s may vary if has 2 alleles

STR PCR (polymerase chain react is used to amplify particular STRs quicker technique than RFLP analysis can be used with less pure samples of DNA or if only have minute sample

PCR

3 Stages to Genome Sequencing Linkage Mapping Physical Mapping DNA Sequencing

Physical Mapping ordering of large fragments cloned in YAC & BAC vectors followed by ordering of smaller fragments cloned in phage & plasmid vectors key is to make overlapping fragments & then use probes or automated nucleotide sequencing of ends to find the overlaps

YAC & BAC 1st cloning vector Yeast Artificial Chromosome Bacterial Artificial Chromosome 1st cloning vector carries inserted fragments million base pairs (bp) long carries inserts of 100,000 – 300,000 bp

Physical Mapping fragments from YAC & BAC put in order each fragment cut into smaller pieces which are then cloned in plasmids, ordered, & finally sequenced

DNA Sequencing determination of nucleotide sequence of each small fragment & assembly of the partial sequences into the complete genome sequence for human genome used sequence machines sequencing of all 3 billion bps in haploid set of human chromosomes done at rate 1,000 bp/s

Human Genome Project took 13 yrs $100 million

Sequencing an Entire Genome

Whole-Genome Shotgun Approach essentially skips the linkage mapping & physical mapping stages & starts with sequencing of DNA fragments from randomly cut DNA computers then assemble the resulting very large # of short sequences into a single continuous sequence

Shotgun Approach

Application of Systems Biology to Medicine 2007 – 2010 set out to find all the common mutations in 3 types of cancer (lung, ovarian, glioblastoma) by comparing gene sequences & patterns of gene expression in cancer cells compared to normal cells

Cancer Genes # genes identified that had been suspect + genes that were not suspected gives researchers point to develop new treatments aimed specifically @ these genes 10 more cancers then studied (most common/most lethal)

Microarray Chip

Genomes Vary in Size, # of Genes, & Gene Density

# of Genes Prokaryotic cells < Eukaryotic cells Humans: expected 50,000 – 100,000 but have found < 30,000 How do we get by with not many more genes than nematodes? # proteins we have > # genes vertebrates use alternative splicing of RNA transcripts

Gene Density # genes in given length of DNA eukaryotes generally have larger genomes but fewer genes in given # of bps humans have 100’s – 1000’s times more bps but only 5 – 15 times as many genes Sooooo: gene density lower in humans than in bacteria

Noncoding DNA includes most of eukaryotic DNA introns most is noncoding DNA between genes

1.5% of our genome codes for proteins, or is transcribed into rRNA or tRNA

Pseudogenes former genes that have accumulated over a long time & no longer produce functional proteins

Repetitive DNA sequences that are present in multiple copies in the genome 75% of this repetitive DNA (44% of entire genome) is made up of units called transposable elements & related sequences

Transposable Elements & Related Sequences found in both prokaryotes & eukaryotes stretches of DNA that can move from one location to another w/in the genome transposition: process where 1 transposable element moves from 1 site to different target site by a type of recombination process

“Jumping” Genes

Transposons Gene that is “jumping” never actually completely detach from the cell’s DNA original and new strands brought together by enzymes & other proteins that bind to DNA 1st evidence came from studying genetics of Indian corn

Movement of Transposons & Retrotransposons 2 types of eukaryotic transposons: Transposons move w/in genome by means of DNA intermediate move & paste or cut & paste both require enzyme transposase (encoded by transposon)

Retrotransposon 2nd type of eukaryotic transposable element move by means of RNA intermediate that is a transcript of retrotransposon DNA always leave copy @ original site during transposition RNA intermediate is converted back to DNA by reverse transcriptase (enzyme encoded by retrotransposon)

Other Repeating DNA probably arises due to mistakes made during DNA replication or recombination ~14% human DNA ~1/3 of this duplications of long stretches of DNA segments copied from 1 chromosomal location to another on same or different chromosome

Simple Sequence DNA Contains many copies of tandemly repeated short sequences: ATTGCGATTGCGATTGCGATTGCG repeated units can be 2 – 500 nucleotides

Short Tandem Repeat (STR) repeating units that are 2 to 5 nucleotides long found on telomeres & centromeres (so may play structural role) # of repeating units can vary w/in same genome and with different alleles this diversity means STR’s can be used in preparing genetic profiles

Other Types of DNA 1.5% of genome: genes that code for proteins, rRNA, tRNA include introns & regulatory sequences associated with genes total amt is 25% of the human genome

Multigene Families <1/2 genes present in 1 copy multigene families: collections of 2 or more identical or very similar genes some identical present in tandem, repeats code for an RNA or histone proteins

rRNA genes repeated tandemly 100’s to 1000’s times in 1 to several clusters in genomes of multicellular eukaryotes helps cells quickly make millions of ribosomes necessary for protein synthesis

Multigene Families of Nonidentical Genes Globins: group of proteins that include the α and β polypeptide subunits of hgb Chromosome 16 encodes for forms of α-globin Chromosome 11, encodes for β-globin different forms are expressed @ different times in development allowing hgb to function effectively in changing environment of developing animal

Fetal-Globin in fetal stage use this globin because it had higher affinity for O2 ensuring the efficient transfer of O2 from mother

Clues to Evolution by looking at arrangement of genes in gene families get insight into evolution of genomes genome w/4gene families in 4 species

Genome Evolution “accidents” in cell division can lead to extra copies of all or parts of a chromosome which can then diverge if 1 set accumulates nucleotide sequence changes

Genome Evolution compare chromosomal organization of genomes among species  info about evolutionary relationships w/in given species rearrangements of genes thought to contribute to emergence of new species

Globin Gene 1 common ancestral globin gene  duplicated & diverged into α and β globin ancestral genes subsequent duplication & random mutation  present day globin genes all genes along the way code for O2 - binding proteins

Globin Genes some copies of the duplicated globin genes have diverged so much that their functions are now substantially different examples: lysozyme: enzyme that destroys bacterial cell walls in mammals, found in sweat, tears, & saliva α-lactalbumin: protein found in milk, contains all a.a.

Gene Evolution rearrangement of exons w/in & between genes during evolution  genes containing multiple copies of similar exons&/or several different exons derived from other genes

Gene Evolution movement of transposable elements or recombination between copies of same element occasionally creates new sequence combinations that are beneficial to the organism new combinations can alter function of genes or their patterns of expression & regulation

Comparing Genome Sequences human & chimpanzee sequences show ~4% differences most due to: insertions deletions duplications

4%

FOXP2 Gene gene that affects speech human & chimp have nucleotide sequence variations

SNPs & CNVs Single Nucleotide Polymorphisms Copy Number Variations variations of both w/in a species can yield information about the evolution of that species

Evo-Devo Biologists Evolutionary Developmental biologists have show that homeotic genes (any of the master regulatory genes that control placement & spatial organization of body parts in animals) & other genes associated with animal development contain a: homeobox region has sequence that is highly conserved among diverse species (animals, plants, yeast)

Homeobox Genes in Fruit Fly & Mouse

Hox Genes genes or groups of genes that are responsible for the lay out of basic body forms set up the head-to-tail organization are general purpose (work in many animal phylums) small changes in them or the genes that control them would lead to major source of evolutionary change

Changes in Expression of Hox Genes have changed over evolutionary time

Comparisons of Animal & Plant Development last common ancestor of plants & animals probably a unicellular eukaryote (100s of millions of years ago) morphogenesis in plants relies on differing planes of cell division & on selective cell enlargement

Comparing Development in Plants & Animals development relies on a cascade of transcriptional regulators turning genes on/off Plants do not use Hox genes, they have another group of genes (Mads-box) can find Hox genes in plants & Mads- box genes in animals but in neither case do they have same major role in development