Xuhua Xia xxia@uottawa.ca http://dambe.bio.uottawa.ca Signposts for translation initiation: An illustration of formulating a research project Xuhua Xia xxia@uottawa.ca http://dambe.bio.uottawa.ca

The Protocol What is known (which involves much reading and doing) Formulating hypothesis based on what is known Derive predictions from the hypothesis: Predictions are always about the relationship between or among measurable variables. Predictions involving variables that cannot be measured is of no value. Design experiments to test the predictions Methods to measure the variables relevant to the prediction Methods to assess the relationship among the variables to confirm or reject the predictions Results All results should be presented with respect to the predictions. Anything that is biologically interesting but not directly related to the predictions should be in the Discussion section Discussion Does the method measure the variables as you intend it to? Does your conclusions depend on assumptions that may not be valid under certain circumstances? .....

E. coli 5’ UTR What is known: From “reading”: signposts for translation initiation should be located at the initiation codon and the sequence upstream of the initiation codon From “doing”: a dramatic pattern

Hypothesis, prediction & methods Hypothesis: the pattern is related to translation initiation, i.e., a dramatic increase in G and dramatic decreases in C and U enhance translation initiation. Prediction: If the hypothesis is correct, then we expect highly expressed genes to exhibit the pattern more strongly than the lowly expressed genes. It is a relationship involving two variables The gene expression The strength of the pattern The variables need to be measurable Methods: how should we measure the variables? Gene expression (CAI or wet lab measurement?) The pattern: graphic characterization

Results testing the predictions Highly expressed genes Lowly expressed genes You could do statistics to show that the pattern in the left is significantly stronger than that in the right, but often a picture is worth 1000 words + 10 p values. Results not directly related to the prediction but should be discussed: the difference in frequency distribution at sites 0-70

Prokaryotic translation initiation Shine-Dalgarno (SD) sequence in the 5’ UTR matches the anti-SD (ASD) sequence at the 3’ end of ssu rRNA SD consensus is AGGAGG, binding to UCCUCC in the 3’ end of ssu rRNA In E. coli, for example, the sequence is AGGAGGU. This sequence helps recruit the ribosome to the mRNA to initiate protein synthesis by aligning it with the start codon. The complementary sequence (UUCCUCC),

ASD: 3’ AUUCCUCCACUA---..5’ SD: 5..--AGGAGG---..AUG–..3’ Secondary structure of E. coli 16S rRNA Yassin A et al. PNAS 2005;102:16620-16625

Refine the hypothesis 16S rRNA 3’ ATTCCTCCACTAGGTTGGCG--- 5’ Z2705 GAGATTAACTCAATCTAGAGGGTATTAATAATG 16S rRNA 3’ ATTCCTCCACTAGGTTGGCG--- 5’ Z5748 CTGAACATACGAATTTAAGGAATAAAGATAATG 16S rRNA 3’ ATTCCTCCACTAGGTTGGCG--- 5’ Z3810 AACCGCCGCTTACCAGCAGGAGGTGATGAAAUG 16S rRNA 3’ ATTCCTCCACTAGGTTGGCG--- 5’ Z2225 TGATCCGCGTATCGGACGTGGAGGTGGTGAATG Multiple SD sequences bind to 16S rRNA exactly 3 nucleotides apart. It is the pairing, not the motif AGGAGG, that is important.

Pairing and reading frame 16S rRNA 3’ ATTCCTCCACTAGGTTGGCG--- 5’ Z4094 CAGTTTAACTAGTGACTTGAGGAAAACCTAATG 16S rRNA 3’ ATTCCTCCACTAGGTTGGCG--- 5’ Z4094 CAGTTTAACTAGTGACTTGAGGAAAACCTAATG 16S rRNA 3’ ATTCCTCCACTAGGTTGGCG--- 5’ Z4981 GGCACACTTAATTATTAAAGGTAATACACTATG 16S rRNA 3’ ATTCCTCCACTAGGTTGGCG--- 5’ Z4981 GGCACACTTAATTATTAAAGGTAATACACTATG 16S rRNA 3’ ATTCCTCCACTAGGTTGGCG--- 5’ Z0849 TATTAGATTTGTATTCACCGGAGTGATGTAATG 16S rRNA 3’ ATTCCTCCACTAGGTTGGCG--- 5’ Z0849 TATTAGATTTGTATTCACCGGAGTGATGTAATG 16S rRNA 3’ ATTCCTCCACTAGGTTGGCG--- 5’ Z0749 CATCTCATCGAAAACACGGAGGAAGTATAGATG 16S rRNA 3’ ATTCCTCCACTAGGTTGGCG--- 5’ Z0749 CATCTCATCGAAAACACGGAGGAAGTATAGATG Multiple SD sequences binds to 16S rRNA 3n nucleotides apart. Hypothesis: the pairing contributes to the determination of the reading frame Prediction: highly expressed genes should exhibit the pattern more strongly than lowly expressed genes Multiple SD sequences bind to 16S rRNA exactly 3 nucleotides apart.

Hypothesis, prediction, tests Pairing between SD sequence and ASD are essential for translation initiation Prediction: Modifying the SD or ASD to disrupt base pairing will reduce protein production The prediction was initially supported (A. Hui, H. de Boer. 1987. PNAS 84:4762–4766 Mutating SD to disrupt the pairing: Protein production decreased Mutating ASD to restore the pairing: Protein production is restored. Many counter examples (SD not needed for initiation): The classic Nirenberg and Matthaei experiment with poly-U P. Melancon et al. 1990. The anti-Shine–Dalgarno region in Escherichia coli 16S ribosomal RNA is not essential for the correct selection of translational starts. Biochemistry, 29:3402–3407 (Removed the last ~30 nt in 16S rRNA) D.C. Fargo et al. 1998 Shine–Dalgarno-like sequences are not required for translation of chloroplast mRNAs in Chlamydomonas reinhardtii chloroplasts or in Escherichia coli Mol. Gen. Genet. 257:271–282 S. Sartorius-Neef, F. Pfeifer. 2004 In vivo studies on putative Shine–Dalgarno Sequences of the halophilic archaeon Halobacterium salinarum Mol. Microbiol., 51:579–588 (Efficient translation of leaderless mRNA) The removal of the last ~30 nt in 16 rRNA lead to reduced protein production, but translation initiation is still at the same initiation codon. Problem: The removal will create another unpaired 3’ tail that can form base pairs with the 5’ UTR or mRNA (Cf: secondary structure of 16S rRNA).

Progress of science Observation Hypothesis Predictions and tests Refine hypothesis to accommodate new observations New hypothesis to accommodate new observations Universally accepted: Working theory New observations contradicting the theory

mRNA AUG ssu Ribosome DtoAUG DtoAUG= 17 SD: purine-rich ASD: pyrimidine-rich DtoAUG ssu Ribosome Fig. 1. Model of SD-aSD interaction and the definition of DtoAUG, the distance in number of nucleotides between the 3’ end of small subunit (ssu) rRNA and the initiation codon AUG (top panel). mRNA is colored in red and ssu ribosome in blue, together with the initiation tRNA coupling with the initiation AUG. The bottom panel illustrates DtoAUG = 17. Z2705 GAGATTAACTCAATCTAGAGGGTATTAATAATG 16S rRNA 3’ ATTCCTCCACTAGGTTGGCG--- 5’ DtoAUG= 17

Fig. 3. Distribution of DtoAUG for putative SD sequences located within 20 nt immediately upstream of the initiation AUG, suggesting that DtoAUG is strongly constrained, presumably with the optimal within the range of 12-18 nucleotides.

Effect of a single substitution E. coli GGAUCACCUCCUUA 3’ B. subtilis UCACCUCCUUUCUA 3’ E. coli E. coli AUGAUG DtoAUG B. subtilis B. subtilis AUG DtoAUG

A new hypothesis An accessible initiation codon is essential for translation initiation (T. Nakamoto 2006 BBRC 341:675-678): A leaderless mRNA can be translated because the initiation AUG is highly accessible at the 5’ end SD and ASD pairing prevents secondary structure formation involving the initiation AUG and makes the AUG more accessible. Synthetic mRNA without the SD sequence but can be efficiently translated are typically without secondary structure, rendering the initiation AUG readily accessible.

Another new hypothesis Translation initiation of both prokaryotic and eukaryotic genes depends on the ssu ribosome scanning along the mRNA Any mechanism that can pause the ssu ribosome near the initiation codon can enhance translation initiation.

Yeast 18S rRNA people.biochem.umass.edu

Yeast 5’ UTR Slide 18 Xuhua Xia This slide shows something peculiar in the 5’UTR of protein-coding genes in the baker’s yeast. The axes A dramatic increase in A and a corresponding decrease in U. Does this pattern have anything to do with translation efficiency? Among the 6000 or so yeast genes, some are highly expressed, i.e., have high protein production, and some are lowly expressed. Is this pattern more dramatic for the highly expressed genes than the lowly expressed genes? Slide 18 Xuhua Xia 18

Gene expression and 5’ UTR These two figures contrasts the pattern between the highly expressed and the lowly expressed genes. The pattern is apparently more dramatic for the highly expressed genes than the lowly expressed genes. This pattern suggests that an increase in A and a reduction in U may have something to do with translation efficiency. Slide 19 Xuhua Xia 19