SCIENTIFIC/COLLABORATIVE ACTIVITIES Summary: 5 seminars, 4+ collaborations, 3+ prospective students - “Modelling protein interactomes” seminars for KMUTT,

Slides:

Advertisements

Similar presentations

Linux Operating System Linux is a free open-source operating system based on Unix. Linux was originally created by Linus Torvalds with the assistance of.

Advertisements

Test-tube or keyboard? Computation in the life sciences.

PowerEdge T20 Customer Presentation. Product overview Customer benefits Use cases Summary PowerEdge T20 Overview 2 PowerEdge T20 mini tower server.

Student & Teacher Education Enhancement Program Mo Amundson ETC, Education-To-Careers office fax

Protein-DNA interactions: amino acid conservation and the effects of mutations on binding specificity Nicholas M. Luscombe and Janet M. Thornton JMB (2002)

August 29, 2002InforMax Confidential1 Vector PathBlazer Product Overview.

10 Genomics, Proteomics and Genetic Engineering. 2 Genomics and Proteomics The field of genomics deals with the DNA sequence, organization, function,

Evaluation of Signaling Cascades Based on the Weights from Microarray and ChIP-seq Data by Zerrin Işık Volkan Atalay Rengül Çetin-Atalay Middle East Technical.

Project list 1.Peptide MHC binding predictions using position specific scoring matrices including pseudo counts and sequences weighting clustering (Hobohm)

Protein Structure and Drug Discovery Workshop To be held at Monash University, Mebourne, Australia October 3 rd to 4 th 2006 Molecular Visualization Learn.

Proteomics Understanding Proteins in the Postgenomic Era.

EECS 395/495 Algorithmic Techniques for Bioinformatics General Introduction 9/27/2012 Ming-Yang Kao 19/27/2012.

1 The Department of Computational Biology University of Pittsburgh School of Medicine Hagai Meirovitch.

341: Introduction to Bioinformatics Dr. Natasa Przulj Deaprtment of Computing Imperial College London

Login: BITseminar Pass: BITseminar2011 Login: BITseminar Pass: BITseminar2011.

Bioinformatics Jan Taylor. A bit about me Biochemistry and Molecular Biology Computer Science, Computational Biology Multivariate statistics Machine learning.

The changes and challenges in supporting learners whatever their devices – an experience of migrating to cloud computing Dr. Kathy Maitland Academic Lead.

Computing For Biology An online course for A-level students Runs 18 th to 29 th August 2014 TCGATTCCAGAACTAGGCATTATAGATAGATTCAG ATAGGACATAGATCGATTCAGATAGGATATAATCG.

Final Project Outline (16/11/2009) Dr. Ahmad BinTouq URL:

Open Web App. Purpose To explain Open Web Apps To explain Open Web Apps To demonstrate some opportunities for a small business with this technology To.

Prediction of avian Influenza A binding preference to human receptor using conformational analysis of receptor bound to hemagglutinin Wanwimon Mokmak,

CS 790 – Bioinformatics Introduction and overview.

y-sa/2.0/. Integrating the Data Prof:Rui Alves Dept Ciencies Mediques Basiques, 1st.

Gary Stormo by Andrew Bardee. History Born 1950 in South Dakota Undergraduate in Biology from Caltech PhD in Molecular Biology from University of Colorado.

ENGR 3410 Computer Architecture* * Fall, Monday & Thursday 10: :50 AM.

Bioinformaticians + Experimentalists = Successful Protein Analysis Katarzyna Poleszak International Institute of Molecular and Cell Biology Laboratory.

Chapter 8 Selecting and Maintaining Digital Resources.

NGS data analysis CCM Seminar series Michael Liang:

Agenda Transcription/Translation Mr. Mahon’s song Write your own song HW – finish/record song.

Workshop Visualization of Biological Complexes October 11-12, 2003.

CSCI 6900/4900 Special Topics in Computer Science Automata and Formal Grammars for Bioinformatics Bioinformatics problems sequence comparison pattern/structure.

Preparing for the course by: Installing SAP Business One Downloading a localized demo database Contents: Appendix 1: Basics Appendix.

CSSE 151: Fundamentals of CS I Dr. Yingwu Zhu Office: ENGR 530 Phone: Emai:

What is Research? My University & Personal Perspective Nancy Amato, Texas A&M University

Transcription/Translation foldable Fold your paper so the two ends meet in the middle. Label Transcription on one side and Translation on the other.

MolIDE2: Homology Modeling Of Protein Oligomers And Complexes Qiang Wang, Qifang Xu, Guoli Wang, and Roland L. Dunbrack, Jr. Fox Chase Cancer Center Philadelphia,

Bioinformatics Core Facility Guglielmo Roma January 2011.

User Management. Basics SDMS shall maintain a database of all users. SDMS shall maintain a database of all users. SDMS shall not limit the number of registered.

Samudrala group - overall research areas CASP6 prediction for T Å C α RMSD for all 70 residues CASP6 prediction for T Å C α RMSD for all.

Biological Signal Detection for Protein Function Prediction Investigators: Yang Dai Prime Grant Support: NSF Problem Statement and Motivation Technical.

Chapter 2 Introduction to Systems Architecture. Chapter goals Discuss the development of automated computing Describe the general capabilities of a computer.

Overview of Bioinformatics 1 Module Denis Manley..

General rules 1. Rule: 2. Rule: 3. Rule: 10. Rule: Ask questions ……………………. 11. Rule: I do not know your skill. If I tell you things you know, please stop.

Jobs, Careers, Internships, Senior Projects and Research Computer Application Development K-12 education Industrial Training Bioinformatics Validation.

Rosetta Steven Bitner. Objectives Introduction How Rosetta works How to get it How to install/use it.

Motivational Lecture: UNIX and computer-aided design of new medicines. Alexey Onufriev.

Topic 1 Roland Dunbrack. Modeling of Biological Units Model data files of single proteins may require –sequence alignment(s) to templates (entry and chain)

GRIDP: Web-enabled Drug Discovery Is there any way I can use computational tools to reduce the number of molecules I have to screen to a manageable number,

VISUALIZATION IN BIOLOGY Rama Viswanathan Professor of Chemistry and Computer Science (At Beloit College since 1983)

Discovery of Therapeutics to Improve Quality of Life Ram Samudrala University of Washington.

Implementing and Supporting the Oregon Public Health Information Network Messaging System (PHINMS) One developer’s perspective. John E. McAdams Development.

Lecture 1.01 Developing the Tools Montreal 2004 Course Introduction John J. Salama.

About Bitochon Technologies Service Software Our online service.

Sequence: PFAM Used example: Database of protein domain families. It is based on manually curated alignments.

Did to Do Plus Security and communication

August ICA Agenda Time Topic 8:00 – 8:15

Alignment table: group 4

SEMINAR 1. Title : Generation of Nucleic Acid Biopolymers with Complex Functionalities 2. Speaker : Prof. Seung Soo Oh (Department of Materials Sci. and.

Jmol Training Session Part I: Introduction to the Protein Data Bank

Protein Structure Prediction and Protein Homology modeling

HP Printer Support Number. Support for HP Computer Support for Update your Printer Drivers 24/7 Support Services Support for Diagnosis & Fixing.

Part I. Introduction and Genetic Engineering

Lab 2: Information Retrieval

COMP564 paper review <title & authors of the paper>

Unit 6 Interactions.

Mr.Halavath Ramesh 16-MCH-001 Dept. of Chemistry Loyola College University of Madras-Chennai.

Mr.Halavath Ramesh 16-MCH-001 Dept. of Chemistry Loyola College University of Madras-Chennai.

Mr.Halavath Ramesh 16-MCH-001 Dept. of Chemistry Loyola College University of Madras-Chennai.

Mr.Halavath Ramesh 16-MCH-001 Dept. of Chemistry Loyola College University of Madras-Chennai.

Modeling of EGFR exon 20 insertions using the 3-dimensional structure of the EGFR kinase domain predicts different interactions with the erlotinib-binding.

Presentation transcript:

SCIENTIFIC/COLLABORATIVE ACTIVITIES Summary: 5 seminars, 4+ collaborations, 3+ prospective students - “Modelling protein interactomes” seminars for KMUTT, BIOTEC, Kasetsart, Mahidol, and Ramathibodi. - Collaboration with Dr. Duangdao on protein-DNA 3D modelling (described next); RNA folding/protein RNA structure prediction. - Collaboration with Dr. Sissades on CYP450 side effect and toxicity prediction; porting our docking code to GPUs. - Collaboration with Dr. Sukathida on neuraminidase mutant structure binding to drugs; Dr. Sukathida has two students who will potentially go to the US. - Collaboration with Drs. Supa and Chak at Kasetsart on influenza vaccine design; student Nipa will potentially return to the US. - Predicted hybrid enzyme structure ranking for Somchai; functional annotation ongoing. - Met with several researchers and students and discussed computational biology topics; 2+ students interested in pursuing studies or doing a postdoc in my group.

TECHNICAL ACTIVITIES Protein-DNA 3D modelling server: > 90% complete. Given a protein sequence, and optional DNA sequence, predict protein-DNA complex at atomic resolution. - Installed Linux on desktop/server. - Downloaded all the RAMP/Protinfo program and source files. - Installation of all software in the RAMP/Protinfo suite. - Modified source code for server/FORTRAN compatability. * - Update protein-DNA complexes on the fly and clean – slow. * - Protein-DNA complex reconstruction and ing. - Expansive design paradigm: will include new protein-DNA complexes as they are available in the PDB, can easily expand to RNA. - RAMP/Protinfo software is now available in house for all sorts of modelling purposes. - Papers with Duangdao; need to benchmark elegantly in paper 1. - Paper 1: A webserver for three-dimensional atomic resolution protein-DNA complex prediction. - Paper 2+: Applications of atomic resolution protein-DNA complex models (inducer/repressor/operator prediction, mutational analyses, multiprotein-DNA complexes).

CALENDAR OF ACTIVITIES dec 02 am meeting with Drs. Duangdao and Supawadee's group dec 02 pm meeting with Dr. Kanyawim dec 08 am lunch with Dr. Prasit dec 14 am talk with Dr. Somchai (from Dr. Lily's lab) on protein design dec 14 pm meeting with Dr. Yongyuth dec 15 pm meeting with Dr. Duangdao and student Wit on RNA folding dec 16 am obtain work permit photo and medical certificate dec 18 am KMUTT seminar "Modelling interactomes" from a dec 18 am meeting with Drs. Morakot and Supaporn (4-5p) dec 21 am BIOTEC seminar "Modelling interactomes" from 9-10a dec 21 pm meeting with KMUTT researcher dec 22 pm meeting with Dr. Sissades and student – started collaboration on drug side effect and toxicity predictions based on CYP450 interactions dec 22 pm first month report dec 23 pm meeting with Somchai (from Dr. Lily's lab) on protein design dec 29 am meeting with Dr. Sissades and students - started second collaboration on porting Samudrala flexible docking code to GPUs jan 08 ** meeting with Dr. Wasun Chantratita and students at Ramathibodi Hospital jan 13 ** seminar "Modelling protein interactomes" and meeting with Drs. Supa Hannongbua and Chak Sangma at Kasetsart University jan 19 ** seminar "Modelling protein interactomes" at Mahidol University Microbiology Dept jan 22 ** meeting at BIOTEC jan ?? ** seminar "Modelling protein interactomes" at Ramathibodi Hospital