Application of New DNA Sequencing Technologies for the Study of Epigenetic Abnormalities in Breast Cancer John R. Edwards Columbia Genome.

Slides:



Advertisements
Similar presentations
LINEs and SINEs ….& towards cancer! Presenter: Manindra Singh Course: MCB 720 (Winter Qt.)
Advertisements

Epigenetics Epigenetics - Heritable changes in gene expression that operate outside of changes in DNA itself - stable changes in gene expression caused.
Epigenetics Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520.
Epigenetics and the brain; the nature of nurture? Anthony Isles Behavioural Genetics Group Cardiff University.
Defective de novo methylation of viral and cellular DNA sequences in ICF syndrome cells Robertson K. et al. Human Molecular Genetics, 2002 Gergana Ugrinova.
Estrogen and its receptors play an important role in breast carcinogenesis. In humans, there are two subtypes of estrogen receptors (ER), ER  and ER ,
Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.
POLYMERASE CHAIN REACTION (PCR). THE TEMPLATE DNA GOES THROUGH A CYCLE OF HEATING AND COOLING TO FORM A NEW STRAND OF DNA THAT ONLY COMPRISES OF THE CANCEROUS.
Searching for TFBSs with TRANSFAC - Hot topics in Bioinformatics.
Epigenetics Lab December 1, 2008 Goals of today’s lab: 1.Understand the basic molecular techniques used in the lab to study epigenetic silencing in cancer.
Epigenome 1. 2 Background: GWAS Genome-Wide Association Studies 3.
Biotechnology. Comparative genomics also has been used to identify recently mobilized transposons in genetically diverse humans. For example, over 600.
The virochip (UCSF) is a spotted microarray. Hybridization of a clinical RNA (cDNA) sample can identify specific viral expression.
The Genome is Organized in Chromatin. Nucleosome Breathing, Opening, and Gaping.
DNA Methylation in Histone H3.3 Lysine to Methionine Mutants Ellie Degen with Stefan Lundgren, Siddhant Jain and Dr. Peter W. Lewis UW Department of Biomolecular.
Remember the limitations? –You must know the sequence of the primer sites to use PCR –How do you go about sequencing regions of a genome about which you.
Microarrays and Their Uses Brad Windle, Ph.D
Chapter 19 Organization and Control of Eukaryotic Genomes (here are at least 6 different modes of eukaryotic gene control…) (Remember: the example of operons.
Epigenetics Heritable characteristics of the genome other than the DNA sequence Heritable during cell-division (mitosis) To a lesser extent also over generations.
Special Topics in Modern Genetics: Epigenetics Honors Genetics Ms. Susan Chabot.
I519 Introduction to Bioinformatics, Fall, 2012
Epigenetic differences arise during the lifetime of monozygotic twins. Mario F. Fraga, Esteban Ballestar, Maria F. Paz et al. Amplification of Intermethylated.
Transcriptional - These mechanisms prevent transcription. Posttranscriptional - These mechanisms control or regulate mRNA after it has been produced.
Lecture 6. Functional Genomics: DNA microarrays and re-sequencing individual genomes by hybridization.
Trends Biomedical Science
PHL 472 Chemical Carcinogens Abdelkader Ashour, Ph.D. 2 nd Lecture.
Comment on “Chromosomal Instability and Tumors Promoted by DNA Hypomethylation” and “Induction of Tumors in Mice by Genomic Hypomethylation” by Allen S.
INTERPRETING GENETIC MUTATIONAL DATA FOR CLINICAL ONCOLOGY Ben Ho Park, M.D., Ph.D. Associate Professor of Oncology Johns Hopkins University May 2014.
DNA Fingerprinting Maryam Ahmed Khan February 14, 2001.
EPIGENETIC REGULATION OF MICRORNA EXPRESSION IN PROSTATE CANCER Seodhna M. Lynch 1, Karla M. O’Neill 1, Michael M. McKenna 2, Colum P. Walsh 1, Declan.
How do eucaryotic gene activator proteins increase the rate of transcription initiation? 1.By activating directly on the transcription machinery. 2.By.
ChIP-seq Downstream Analysis Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520.
Warm up  1. How is DNA packaged into Chromosomes?  2. What are pseudogenes?  3. Contrast DNA methylation to histone acetylation (remember the movie.
Epigenetics of cancer Vilja ja Mia.
GENETIC BIOMARKERS.
Figure 1. miRNA in NETs PNET SB-NET miR-7-5p miR-19a miR-96 miR-182
Role of DNA Methylation in the Development of Diffuse-Type Gastric Cancer Digestion 2011;83:241–249 - DOI: / Fig. 1.a DNA methyltransferases.
Distribution of CpG dinucleotide in the human genome and differences in methylation patterns between normal and tumor cells. In the majority of the mammalian.
Epigenetic Affects of the Krüppel-Like Transcription Factor 1 on DNA Methylation By Steven Jermstad.
Companion PowerPoint slide set DNA Methylation & Cadmium Exposure in utero An Epigenetic Analysis Activity for Students This teacher slide set was created.
Companion PowerPoint slide set DNA Methylation & Cadmium Exposure in utero An Epigenetic Analysis Activity for Students This teacher slide set was created.
Companion PowerPoint slide set DNA Methylation & Cadmium Exposure in utero An Epigenetic Analysis Activity for Students This teacher slide set was created.
Companion PowerPoint slide set DNA Methylation & Cadmium Exposure in utero An Epigenetic Analysis Activity for Students This teacher slide set was created.
Genome-Wide Identification and Validation of a Novel Methylation Biomarker, SDC2, for Blood-Based Detection of Colorectal Cancer  TaeJeong Oh, Nayoung.
Companion PowerPoint slide set DNA Methylation & Cadmium Exposure in utero An Epigenetic Analysis Activity for Students This teacher slide set was created.
Detection of Aberrant TERT Promoter Methylation by Combined Bisulfite Restriction Enzyme Analysis for Cancer Diagnosis  Seungjae Lee, Sumit Borah, Armita.
High-Resolution Profiling of Histone Methylations in the Human Genome
High-throughput analysis of informative CpG sites for the four studied tumor suppressor genes (A-D). High-throughput analysis of informative CpG sites.
Volume 133, Issue 6, Pages (December 2007)
Ying-Ying Yu, Ph. D. , Cui-Xiang Sun, Ph. D. , Yin-Kun Liu, Ph. D
Genetics and Epigenetics of the Skin Meet Deep Sequence
Benjamin P. Song, Surbhi Jain, Selena Y. Lin, Quan Chen, Timothy M
High-Resolution Profiling of Histone Methylations in the Human Genome
Epigenetics modification
Same genes, different phenotypes
Volume 17, Issue 1, Pages (January 2007)
AIM1 and LINE-1 Epigenetic Aberrations in Tumor and Serum Relate to Melanoma Progression and Disease Outcome  Sojun Hoshimoto, Christine T. Kuo, Kelly.
Supplementary Table Primer Sequence Reference Region 1 BS-CTCF-725-F
Gene expression of epigenetic modulators, HDAC1 and Dnmt1, and the histone acetylation modification patterns by the prenatal/maternal BSp dietary treatment.
Diagrammatic representation of the LMPCR footprinting technique.
The TSDR of ATL cells exhibits Treg-like hypomethylated status or CD4+ conventional T cell–like methylated status. The TSDR of ATL cells exhibits Treg-like.
Gene Expression II Kim Foreman, PhD
Methylation status of IGFBPL1 in human breast cancer.
Epigenetic regulation of p16INK4a in human gastric cancer.
Regional plot and genome browser view of 14q13.
Methylation-specific PCR of APC, RASSF1A, and p14ARF genes in bladder tumor and urine DNAs. In the APC gel panel viewed from left to right, the first (TCC34)
Representative images demonstrating LOH in breast cancer patients’ paired BM aspirate and primary tumors (T) at D14S62, D14S51, and D8S321, respectively.
CpG Methylation Analysis—Current Status of Clinical Assays and Potential Applications in Molecular Diagnostics  Antonia R. Sepulveda, Dan Jones, Shuji.
Epigenetics.
A, Epigenetic validation results of CBFA2T3 and GABBR2, which were first screened by MSCC sequencing and further confirmed by a Sequenom EpiTYPER assay.
Presentation transcript:

Application of New DNA Sequencing Technologies for the Study of Epigenetic Abnormalities in Breast Cancer John R. Edwards Columbia Genome Center July 25th, 2007

Sequencing by Synthesis A new paradigm in genomic sequencing

DNA Polymerase Reaction

DNA Polymerase Reaction Modifications

G - Linker - O-Block-3’ Sequencing by Synthesis ACGCTAGCGATCATGCAGCTGCATCGACGCTAGCGATCATGCAGCTGCATCG TGCGATCGTGCGATCG Template Primer C A T

Structure of the Polymerase-DNA-Nucleotide Complex Pelletier et al. (1994) Science 264,

Ju J, Li Z, Edwards JR, Itagaki Y. U.S. Patent (2003) 6,664,079 DNA Sequencing by Synthesis (SBS) on a Chip

J. Ju et al. PNAS, 2006, 103: Molecular Structures of 3’-O-Allyl-dNTP- Allyl-Dye Nucleotide Analogues

Emulsion PCR Based DNA Template Preparation

Methylation Landscape of the Human Genome

CpG Methylation and Transcription Jones and Takai (2001) Science 293:

CpG Composition of the Human Genome

Fractionation of the Genome

McrBC and RE Digests

Fractionation and Analysis Pipeline

Fractionation Methods Show an Unbiased Coverage of the Genome McrBC = 3073 sequences RE = 2565 sequences

Custom Methylation Tracks on the UCSC Genome Browser

Methylation Status of Promoters

Alu Elements are Highly Methylated

Categorical Breakdown of Methylated and Unmethylated Compartments

Methylation Limits the Effective Size of the Genome Small Genome Large Genome

Whole-genome Profiling of Breast Cancer

DNA Methylation in Cancer M. Esteller (2005) Annual Review of Pharmacology and Toxicology 45: Genomic Hypomethylation Genomic instability? Activation of proto-oncogenes? Loss of Imprinting?

New Tools to Probe DNA Methylation in Breast Cancer Technology Requirements Whole genome approach Must examine state of repetitive elements Unbiased Must be useable for primary tumors Goals Characterize complete methylation profile of breast cancer Compare normal/tumor, tumor/tumor, tumor/cell-line Investigate potential as biomarker Understand patterns of global hypomethylation and regional hypermethylation

Whole-Genome Methylation Profiling

Acknowledgements Acknowledgements Jingyue Ju Timothy Bestor (Genetics and Development) Nicholas Turro (Chemistry) Victoria Haghighi (Psychiatry) Ju Lab James J. Russo Zengmin Li Lanrong BiXiaoxu Li Shundi ShiDae H. Kim Qingleng MengXiaopeng Bai Bestor Lab Rob Rollins Anne O’Donnell National Human Genome Research Institute/NIH NSF, Packard Foundation