NMR Shielding and Antimalarial Drugs Angel C. de Dios Georgetown University 13.

Slides:

Advertisements

Similar presentations

Everardo Macias, Patrick Tomboc Eamonn F. Healy, Chemistry Department,

Advertisements

Anemia: The Weak and Sickly Illness Anemia is a blood condition involving the abnormal reduction of red blood cells resulting in iron deficiency, oxygen.

Selectivity in an Encapsulated Cycloaddition Reaction Jian Chen and Julius Rebek,Jr. Org. Lett. 2002, 4, Tobe laboratory Shintaro Itano.

Homo-halogen Bonding in 2-iodo-perfluoroalkane Darin J. Ulness Department of Chemistry Concordia College, Moorhead, MN.

Lecture 4 Quantitative MO Theory for Beginners: Cyclic p Systems

Jakub Kostal & Steve Sontum Thesis Presentation ‘06.

1.L. J. Andrews, Chem. Rev. 1954, 54, R. E. Rundle, J. H. Goring, J. Am. Chem. Soc. 1950, 72, M. B.Dines, J. Organomet. Chem. 1974,

Solid-state 31 P and 13 C NMR of extremely bulky phosphines René T. Boeré, Paul Hazendonk and Dinu Iuga Department of Chemistry and Biochemistry and Department.

1 CHEM 212 – NMR Spectroscopy Spring Spectral Analysis – 1 H NMRNMR Spectroscopy NMR Spectral Analysis – Introductory 1 H NMR 1.NMR is rarely.

Spectroscopy nuclear magnetic resonance. The nmr spectra included in this presentation have been taken from the SDBS database with permission. National.

Quantitative Structure-Activity Relationships (QSAR)  Attempts to identify and quantitate physicochemical properties of a drug in relation to its biological.

GGAGATTCTGGGCCACTTTGGTTCCCCATGAGCCAAGACGGCACTTCTAATTTGCATTCCCTACCGGAGTCCCTGTCTGTAGCCAGCCTGGCTTTCAGCTGGTGCCCAAAGTGACAAATGTATCTGCAATGACAAAGGTAC CCTGGAAGGGCTCGCCCTCTGCGGAATTTCAGTTCATGCAGGCCTTGGTGCTTCCACATCTGTCCAAGGGCCTTTCAAATGTGACTTTTAACTCTGTGGATTGATTTGCCCGG

Determination of Spin-Lattice Relaxation Time using 13C NMR

Magnetic Resonance Contributions to Other Sciences Norman F. Ramsey Harvard University Principles of Magnetic Resonance First experiments Extensions to.

1 Li Xiao and Lichang Wang Department of Chemistry & Biochemistry Southern Illinois University Carbondale The Structure Effect of Pt Clusters on the Vibrational.

1 Nuclear Magnetic Resonance Spectroscopy 13 C NMR 13 C Spectra are easier to analyze than 1 H spectra because the signals are not split. Each type of.

Chromatography (Separations) Mass Spectrometry Infrared (IR) Spectroscopy Nuclear Magnetic Resonance (NMR) Spectroscopy X-ray Crystallography (visual solid.

Synthetic Approach to 5,6-Benzo-1-azabicyclo[2.2.2]octan- 2-one: A Lactam having Zero Resonance Energy Meghan Tobin, Dr. Arthur Greenberg, Jessica Morgan.

Welcome Professor Lin to direct our group!. 2 Self-introduction Name: Yulei.Hao Hometown: Shou County in Anhui Province Mother school: Hefei University.

Christian R. Goldsmith Auburn University Department of Chemistry and Biochemistry.

Fig. 1. Images of the three E-field cells. Two cells fit inside a 5 mm NMR tube (a) and produce and E-field  (b) and // (c) to the B o field. The third.

Ab Initio and DFT Calculations for the Vibrational Frequencies and Barrier to Planarity of Cyclopentene and its Deuterated Isotopomers Abdulaziz Al-Saadi.

Performance of Molecular Polarization Methods Marco Masia.

Chemistry 2 Lecture 4 Quantitative MO Theory for Beginners: Cyclic  Systems.

Aromatics: Long-Range Coupling H’s on aromatic rings may couple with non-neighboring protons due to long-range coupling. You will see this in lab! Why?

Pulsed Field Ionization-Zero Electron Kinetic Energy (PFI-ZEKE) Spectroscopy of Sc-C 6 H 5 X(X=F,CH 3,OH) Complexes Changhua Zhang, Serge A. Krasnokutskia.

Structures of Hydrated Alkali Metal Cations, using Infrared Photodissociation Spectroscopy Haochen Ke, Christian van der Linde, James M. Lisy Department.

1 A Study of Hydroxycyclohexadienyl Radical Absorption Using Time-Resolved Resonance Raman Spectroscopy Deanna O’Donnell University of Notre Dame Radiation.

Rotational Spectra and Structure of Phenylacetylene-Water Complex and Phenylacetylene-H 2 S (preliminary) Mausumi Goswami, L. Narasimhan, S. T. Manju and.

Kirill P. Birin, Yulia G. Gorbunova, Aslan Yu. Tsivadze Lviv, 2010.

NMR Detected Hydrogen-Deuterium Exchange Reveals Differential Dynamics of Antibiotic and Nucleotide Bound Aminoglycoside Phosphotransferase 3′-IIIa Adrianne.

Summary of Collaborative Investigation – Na 5 ACu 4 (AsO 4 ) 4 Cl 2 (A = Rb, Cs) Jeffrey Clayhold, Miami University, USA Shiou-Jyh Hwu, Clemson University,

 A brand new workflow tool for research chemists & related science  Largest database of chemical properties and reaction data presented with chemistry.

SOLUBILITY OF WATER IN LIQUID PERFLUOROCARBONS M. G. Freire 1, L. M. N. B. F. Santos 2, I.M. Marrucho 1 and J.A.P. Coutinho 1 1 CICECO, Departamento de.

Abel Blazevic GSI Plasma Physics/TU Darmstadt June 8, 2004 Energy loss of heavy ions in dense plasma Goal: To understand the interaction of heavy ions.

Sandra C. Balanga, Maria Benavides, PhD Department of Natural Sciences Abstract : This study focuses on determining.

Optical Zeeman Spectroscopy of Iron Monohydride, FeH Jinhai Chen, Timothy C. Steimle Department of Chemistry and Biochemistry, Arizona State University.

1 σ-Aromaticity about cyclopropene Dewar firstly deduced in 1979, that cyclopropene should have σ-Aromaticity with the aromaticity energy to cyclopropane.

[Ru(H)(H 2 )(PPh 2 CH 2 CH 2 PPh 2 ) 2 ] + 1 Albinati, A. et al., Inorg. Chim. Acta 259, 1997,

Barney Ellison — ISMS, RB05

Since Demas and Adamson’s introduction of tris(2,2’-bipyrdine)ruthenium(II) as a photosensitizer, numerous applications have been developed to take advantage.

Role of Histidine 55 in the Dimerization of the Cytoplasmic Dynein Subunit LC8 Loren Cochrun Dr. Elisar Barbar Department of Biochemistry & Biophysics.

Introduction to Chemistry The Six Main Branches of Chemistry.

Jaran Eriksen MD, PhD Student International Health (IHCAR) & Clinical Pharmacology Karolinska Institute, Stockholm, Sweden.

Microwave Spectroscopic Investigations of the Xe-H 2 O and Xe-(H 2 O) 2 van der Waals Complexes Qing Wen and Wolfgang Jäger Department of Chemistry, University.

OSU – June – SGK1 ADAM DALY, STEVE KUKOLICH, Dept. of Chemistry and Biochemistry, The University of Arizona, Tucson, Arizona CHAKREE TANJAROON,

Rotational Spectra of Adducts of Formaldehyde with Freons Qian Gou, 1 Gang Feng, 1 Luca Evangelisti, 1 Montserrat Vallejo-López, 2 Alberto Lesarri, 2 Walther.

Nitrogen–Carbon Bond Formation from N 2 and CO 2 Promoted by a Hafnocene Dinitrogen Complex Yields a Substituted Hydrazine Wesley H. Bernskoetter, Emil.

Erin M. Duffy, Brett M. Marsh, Jonathan M. Voss, Etienne Garand University of Wisconsin, Madison International Symposium on Molecular Spectroscopy June.

Magnetism of molecular compounds Christian Limberg.

Spectroscopy nuclear magnetic resonance.

Towards the Synthesis and Characterization of Copper(I)-Arene Compounds Using Phenyl- and Naphthyl-Appended NS2-Macrocyclic Ligands Thora R. Maltais.;

CHEM 212 – NMR Spectroscopy

Chem 345: Please Read Three Handouts White Problem Set Yellow Syllabus

Chemistry 301 Q1 September 26, 2017: Agenda

STEPHEN G. KUKOLICH, MING SUN, ADAM M. DALY University of Arizona

Eric Amerling & Christine Nervig University of Utah

Lan Cheng Department of Chemistry The Johns Hopkins University

NUCLEAR MAGNETIC RESONANCE in medical field

CZ3253: Computer Aided Drug design Introduction about the module Prof

Metastable States Arising from the Ablation of Solid Copper

Calculations Based on Chemical Equations

Nuclear Magnetic Resonance (NMR) Spectroscopy

Homo-halogen Bonding in 2-iodo-perfluoroalkane

1H NMR Interpretation Number of Signals (Resonances)

CH 14-3: Unknown Analysis of Benzene

Single-File Diffusion in Crystalline Molecular Wheel Nanotubes

Non-Calculator Questions

1H NMR Interpretation Number of Signals (Resonances)

1H NMR Number of Signals (Resonances)

Presentation transcript:

NMR Shielding and Antimalarial Drugs Angel C. de Dios Georgetown University 13

Chloroquine Resistance, travel/diseases/maps

Antimalarial Drugs Pagola, S.; Stephens, P. W.; Bohle, D. S.; Kosar, A. D.; Madsen, S. K. Nature, 404, 307 (2000) Leed, A.; DuBay, K.; Ursos, L. M. B.; Sears, D. N.; de Dios, A. C.; Roepe, P. D. Biochemistry, 41, (2002) Red Blood Cell Hemoglobin Digestion Heme Hemozoin

Casabianca, L. B.; de Dios, A. C. J. Phys. Chem. A, 108 (40), , (2004) Chloroquine Amodiaquine Quinine

Quinine carbon 8 J. Phys. Chem. A, 108 (40), , 2004

Quinine observed chemical shift Carbon310 mM9.5 mM dd mm Casabianca, L. B.; de Dios, A. C. J. Phys. Chem. A, 108 (40), , (2004)

Casabianca, L. B.; de Dios, A. C. Magn. Reson. Chem., 44, (2006) Interactions between drug molecules

Leed, A.; DuBay, K.; Ursos, L. M. B.; Sears, D. N.; de Dios, A. C.; Roepe, P. D. Biochemistry, 41, (2002) de Dios, A.C.; Casabianca, L.B.; Kosar, A.; Roepe, P.D. Inorg. Chem., 43, , (2004) Solution structures of drug-heme complex

Biochemistry, 41 (32), , (2002)

Tumambac, G. E.; Wolf, C. J. Org. Chem. 69, 2048 (2004) Tumambac, G. E.; Wolf, C. J. Org. Chem. 70, 2930 (2005) Experimental Chemical Shift* Carbon III Difference ,8-bis(2-isopropyl-4-quinolyl)naphthalene Chemical shifts and  electron density Search for a Quantitative Structure-Activity Relationship (QSAR)

Ramsey’s Equations for Calculating Chemical Shielding Ramsey, N. F. Phys. Rev. 1950, 78, de Dios, A.C. Prog. NMR Spectrosc. 1996, 29,

Shielding Tensors in Aromatic Rings

Strub, H.; Beeler, A. J.; Grant, D. M.; Michl, J.; Cutts, P. W.; Zilm, K. W. J. Am. Chem. Soc., 105, 3333, (1983)

Calculated Shielding Differences Casabianca, L.B.; Faller, C.M. Faller; de Dios, A.C. J. Phys. Chem. A, 110, , (2006)

Quinine

Maps of  11 “  -electron density” B A

Heme

Heme-Drug

Heme-Drug Solution Structures Leed, A.; DuBay, K.; Ursos, L. M. B.; Sears, D. N.; de Dios, A. C.; Roepe, P. D. Biochemistry 41, (2002) de Dios, A. C.; Casabianca, L. B.; Kosar, A. D.; Roepe, P. D. Inorg. Chem. 43, 8078 (2004) Electron-RichElectron-Poor

Substituted Aminoquinolines Log K values from Kaschula, C. H.; Egan, T. J.; Hunter, R.; Basilico, N.; Parapini, S.; Taramelli, D.; Pasini, E.; Monti, D. J. Med. Chem. 45, 3531 (2002)

de Dios, A.C.; Tycko, R.; Ursos, L.M.B.; Roepe, P.D. J. Phys. Chem. A, 107 (30), , (2003) Solid State NMR Studies

de Dios, A.C.; Tycko, R.; Ursos, L.M.B.; Roepe, P.D. J. Phys. Chem. A, 107 (30), , (2003)

de Dios, A.C.; Tycko, R.; Ursos, L.M.B.; Roepe, P.D. J. Phys. Chem. A, 107 (30), , (2003)

de Dios, A.C.; Tycko, R.; Ursos, L.M.B.; Roepe, P.D. J. Phys. Chem. A, 107 (30), , (2003)

de Dios, A.C.; Tycko, R.; Ursos, L.M.B.; Roepe, P.D. J. Phys. Chem. A, 107 (30), , (2003)

Acknowledgements National Institutes of Health National Institutes of Health Georgetown University Georgetown University Luce Foundation Luce Foundation ARCS Foundation ARCS Foundation Prof. Paul Roepe, PhD Leah Casabianca Lyann Ursos, PhD Alison Leed Kateri DuBay Devin Sears, PhD Caitlyn Faller Prof. Christian Wolf, PhD NIH (Robert Tycko’s group)