Sporadic ALS and rs12608932 Amyotrophic lateral sclerosis Spoardic ALS estimated heritability: 0.35-0.85 Located in intron of UNC13A gene on chromosome.

Slides:

Advertisements

Similar presentations

AllerGen / Vancouver - 01/03//2009 Meta-Analysis of GABRIEL GWAS Asthma & IgE F. Demenais, M. Farrall, D. Strachan GABRIEL Statistical Group.

Advertisements

Single Nucleotide Polymorphism And Association Studies Stat 115 Dec 12, 2006.

Pavel Tarlykov, PhD General Genetics LTD Astana, Kazakhstan Raleigh, 2014.

Adiponectin: Understanding the regulation of a metabolically important protein hormone. Bethany Schaffer Personalized Medicine and Genomics May 29, 2012.

Understanding GWAS Chip Design – Linkage Disequilibrium and HapMap Peter Castaldi January 29, 2013.

Published Genome-Wide Associations through ,617 published GWA at p≤5X10 -8 for 249 traits Autism marker Multiple Sclerosis Marker The GWAS Human.

Challenges of an Epidemiologist Working in Genomics Wendy Post, MD, MS Associate Professor of Medicine and Epidemiology Cardiology Division Johns Hopkins.

1 FSTL4 and SEMA5A are associated with alcohol dependence: meta- analysis of two genome-wide association studies Kesheng Wang, PhD Department of Biostatistics.

Class activity: What are my asthma variants doing? In the subset of individuals for whom expression data are available, the T nucleotide allele at rs

3%20GWASancestry.pptx.

 Genes are found on the X AND Y chromosomes.  Genes that are carried on the sex chromosomes are called sex linked genes.

Class GWAS Go to genotation.stanford.edu Go to “traits”, then “GWAS” Look up your SNPs Fill out the table Submit information.

Genome Variations & GWAS

Modes of selection on quantitative traits. Directional selection The population responds to selection when the mean value changes in one direction Here,

IBD genetics in children across diverse populations Subra Kugathasan, MD Professor of Pediatrics and Human Genetics Emory University.

Molecular and Genetic Epidemiology Kathryn Penney, ScD January 5, 2012.

Rs Vanessa Burns Gene 210 SNP. rs Involved in lung vascular development and skeletogenesis PrrX1-/- mice are embryonic lethal – Cleft palate.

Chapter 25 Chapter 25 Genetic Determinants of Osteoporosis Copyright © 2013 Elsevier Inc. All rights reserved.

Figure S1. Quantile-quantile plot in –log10 scale for the individual studies The red line represents concordance of observed and expected values. The shaded.

Biology 101 DNA: elegant simplicity A molecule consisting of two strands that wrap around each other to form a “twisted ladder” shape, with the.

Gene Hunting: Linkage and Association

From Genome-Wide Association Studies to Medicine Florian Schmitzberger - CS 374 – 4/28/2009 Stanford University Biomedical Informatics

Two RANTES gene polymorphisms and their haplotypes in patients with myocardial infarction from two Slavonic populations Two RANTES gene polymorphisms and.

10/07/08 Journal Club Simone Sanna-Cherchi. OUTLINE Basis of Admixture Mapping as strategy do identify disease-associated genes Papers Implications.

Introduction: Human Population Genomics ACGTTTGACTGAGGAGTTTACGGGAGCAAAGCGGCGTCATTGCTATTCGTATCTGTTTAG.

Melanie Dunn 9/20/2011.  Rheumatoid arthritis (RA) is a chronic disease that leads to inflammation of the joints and surrounding tissues that can also.

Have your clickers ready!. Countdown The theory of evolution. 2. Discovery of DNA. 3. The first Laws of Heredity. 4. Description of the human genome.

Prof. Dr. H. Schunkert Medizinische Klinik II UK S-H Campus Lübeck Genome-wide association for myocardial infarction.

FaceBase Kick-Off Meeting Nov 15-16, 2009 Bethesda Oral Clefts: Moving from Genome Wide Studies Toward Functional Genomics TH Beaty for Alan F Scott, Ingo.

Supplementary Table 1.

The International Consortium. The International HapMap Project.

Design and Validation of Methods Searching for Risk Factors in Genotype Case- Control Studies Dumitru Brinza Alexander Zelikovsky Department of Computer.

Genetic Association Study Principles: Andrew C. Heath.

KAWASAKI DISEASE RISK-ASSOCIATED SNPS As Identified by Lee et al., 2012 Jennifer Przybylo.

The socio-economic gradient in children’s reading skills and the role of genetics 1.

Figure S1 Figure S1. Search results of single nucleotide polymorphism (SNP) of rs of the GRIK1 gene used in this study (

IntroductionPatient baseline characteristics Conclusion The process of EGFR recycling is important mechanism of resistance of cetuximab in colorectal cancer.

Linkage. Announcements Problem set 1 is available for download. Due April 14. class videos are available from a link on the schedule web page, and at.

Linkage. Announcements Problem set 1 is available for download. Due April 14. class videos are available from a link on the schedule web page, and at.

EBF FLJ31951UBLCP1 IL12B B36 Position Genes LD Regions Genotyped Markers Chr5 (q33.3) rs rs Figure 1. Physical map of 360kb around IL12B.

Genome-Wides Association Studies (GWAS) Veryan Codd.

Genetic Analysis in Human Disease Kim R. Simpfendorfer, PhD Robert S.Boas Center for Genomics & Human Genetics The Feinstein Institute for Medical Research.

Date of download: 7/2/2016 Copyright © 2016 American Medical Association. All rights reserved. From: Genome-wide Interrogation of Germline Genetic Variation.

Peng Yin1, Andrea L Jorgensen1, Andrew P Morris1, Richard Turner2, Richard Fitzgerald2, Rod Stables3, Anita Hanson2, Munir Pirmohamed2 1. Department of.

LAB: Study of genetic variants with Internet recourses.

Disease risk prediction

Genetics of common complex diseases: a view from Iceland

14-2 Human Chromosomes Fill-in Notes Questions to think about:

What should be in your SNPedia write-up?

Gene Hunting: Design and statistics

Figure 2 ALSFRS-R changes (A) Amyotrophic Lateral Sclerosis Functional Rating Scale-Revised (ALSFRS-R) slope after 6 months of treatment without (left)

Itsik Pe’er, Yves R. Chretien, Paul I. W. de Bakker, Jeffrey C

PNPLA3 gene in liver diseases

Bertram et al. (2005) , NEJM, 352: Bertram et al. (2005) , NEJM, 352:

PREMIER: Rate of hypertension at 18 months

Lipopolysaccharide binding protein promoter variants influence the risk for Gram-negative bacteremia and mortality after allogeneic hematopoietic cell.

Culminating Performance Task

Relationship between Genotype and Phenotype

Exercise: Effect of the IL6R gene on IL-6R concentration

Variants at HLA-A, HLA-C, and HLA-DQB1 Confer Risk of Psoriasis Vulgaris in Japanese Jun Hirata, Tomomitsu Hirota, Takeshi Ozeki, Masahiro Kanai, Takeaki.

Genetic variations associated with diabetic nephropathy and type II diabetes in a Japanese population S. Maeda, N. Osawa, T. Hayashi, S. Tsukada, M.

Elliott P, et al. JAMA 2009;302:37-48.

The Genetic of Earwax Wet earwax is a dominant allele!

Wenting Wu, Christopher I. Amos, Jeffrey E. Lee, Qingyi Wei, Kavita Y

Patient Disposition James A. de Lemos et al. JAMA 2004; 292:

Effect of VKORC1 Haplotype Combination on Clinical Warfarin Dose - Common haplotypes (H1, H2, H7, H8, and H9) were clustered with use of the UPGMA method.

Figure 2. Odds ratios (ORs) from the multivariate logistic regression analysis and hazard ratios (HRs) from the Cox regression analysis Odds ratios (ORs)

Results from a GWAS of prostate cancer in the KP population (8,399 cases and 38,745 controls), highlighting key chromosomal regions. Results from a GWAS.

Germline variants influencing primary tumor type.

Presentation transcript:

Sporadic ALS and rs Amyotrophic lateral sclerosis Spoardic ALS estimated heritability: Located in intron of UNC13A gene on chromosome 19 Major allele: A Minor (risk) allele: C Unc13a Protein Neurotransmitter Synaptic Vesicle Broadie, K.S., et al

Two-stage GWAS Phase I: Genome wide studyPhase II: Replication European ancestry Cases: 2,323 Controls: 9,013 Identified 58 SNPs with P<1.0x10 -4 Including rs (P =1.30x10 -9, OR=1.25) European ancestry Cases: 2,532 Controls: 5,940 rs P= 1.86x10 -6, OR=1.20 Combined P=2.50x Van Es, M., et al

Replication Studies French population (2010) 285 Cases and 285 Controls rs : P = 0.85 East Asian population (2011) Japanese 1179 Cases and 1645 Controls P=0.67 Odds ratio = 1.02 Chinese 684 Cases and 830 Controls P=0.73 Odds ratio = 1.02 Association with Survivability (2012) Monitored survivability of Dutch, Swedish, Belgian ancestry Recessive model Patients with CC exhibited 5-10 months shorter survivability (than those with AC or AA) Daoud, H., et al Iida, A., et al rs Significant association not seen in all replication studies Sample size too small (?) Population dependence (?)