Epidemiology of Rabies in Southeast Europe

Slides:

Advertisements

Similar presentations

Share of population - GDP per capita (PPP), 2004 EU-15 and other West European countries Hungary Czech Republic Malta Slovenia Cyprus Portugal Greece Spain.

Advertisements

1 Molecular epidemiology of lyssaviruses in Eurasia Dr Lorraine McElhinney Veterinary Laboratories Agency (Weybridge), UK.

The European Law Students Association Albania ˙ Austria ˙ Azerbaijan ˙ Belgium ˙ Bosnia and Herzegovina ˙ Bulgaria ˙ Croatia ˙ Cyprus ˙ Czech Republic.

A changing world ● Globalisation / Globalisations? Global trade (ESPON - Europe in the world – 2007)

European Association of Establishments for Veterinary Education and Evaluation of the „Vet-Schools“ Brussels, 6 October 2008 Marcel Wanner.

Magician or Math-a-magician?. Math Magic Math Magic – Trick #1 Pick a number… any number! (keep it a secret though) Add 1 to that number Multiply by.

NATO and Southeast Europe Prof.dr.sc. Lidija Čehulić-Vukadinović.

UNIVERSITY OF JYVÄSKYLÄ INTERNATIONAL COOPERATION.

Longitude/Latitude Prime Meridian/Equator Oceans Tropics Continents

Eastern Europe: Poland, Lithuania, Latvia, Estonia, Russia, Ukraine, Romania, Bulgaria, Macedonia, Albania, Belarus, Bosnia and Herzegovina, Croatia, Slovenia,

Political Map of Europe. 1. British Isles 2. Nordic Nations 3. Central Western Europe 4. Mediterranean Europe 5. Eastern Europe.

INTERREG III B CADSES Neighbourhood Programme Letterio DENARO Managing Authority INTERREG III B CADSES Neighbourhood Programme Trasnational.

Regional Tourism in Europe Geography of Tourism. The British Isles.

Knowledge Management LXV International Council Meeting Qawra, Malta 16 th - 23 rd of March 2014.

Study Visits ICM Croatia, Opatija, 27th October to 3th November 2013.

ELSA Shop(ping) – Spring SALE! LXV International Council Meeting Qawra, Malta 16 th - 23 rd of March 2014.

Knowledge Management and Transition ICM Cluj-Napoca, 24th April 2015.

ELSA Shop(ping) LXIV International Council Meeting Opatija, Croatia October 28 th - November 3 rd 2013.

Area Definition III KAM,Bratislava. The European Law Students’ Association Albania ˙ Austria ˙ Azerbaijan ˙ Belgium ˙ Bosnia and Herzegovina ˙ Bulgaria.

Jana Hrabcová and Jana Musilová.  Organization of the course  Definition of the concept of Central Europe and the Introduction to the History of Central.

ELSA Law Schools ICM Cluj-Napoca, 21st April 2015.

Countries 10 pts 10 pts 5 pts 5 pts 15 pts 15 pts 20 pts 20 ptsCulture 5 pts 5 pts 10 pts 10 pts 15 pts 15 pts 20 pts 20 pts 10 pts 10 pts 5 pts 5 pts.

Make it Smart&Creative ICM Cluj-Napoca, 21st April 2015.

Political Map of Europe Central and Southeastern European Countries.

ICM Bodrum 24 th October AA Workshop Legal Research Group.

NextLastEurope. NextLastEurope  The region of Europe is the area on the map shaded dark purple. Europe.

EASTERN EUROPE Dominated by the USSR until 1990 Europe’s Poorest Region Influenced by Russia political and economic instability common.

Institutional Visit LXV International Council Meeting Qawra, Malta 16 th - 23 rd of March 2014.

Poland Czech Republic Slovakia Hungary Croatia Serbia Bosnia & Herzegovina Slovenia Montenegro Russia Atlantic Ocean Arctic Ocean Austria Netherlands Belgium.

ELSA as the Franchise? LXV International Council Meeting Qawra, Malta 16 th - 23 rd of March 2014.

SPORTS MEDICINE SPECIALIZATION – 24 countries 1)Belarus 13)Romania 2) Bosnia & Herzegovina 14)Serbia 3) Bulgaria 15)Slovenia 4) Czech Republic 16)Spain.

1 Investment Compact for South East Europe Attracting Foreign Direct Investment: A Comparative Overview of the FDI in the South East European Countries.

EXTREME MAKEOVER Members’ Magazine LXIV International Council Meeting Opatija, Croatia October 28 th - November 3 rd 2013.

Map - Region 3 Europe.

Map Quiz #7 Review World Geography Mr. Wofford. Map Quiz #7 Review Continents, Oceans, Seas, Deserts, Mountains U S A North America South America.

Eastern Europe in 1989 included eight nations: Albania, Bulgaria, Czecholsovakia, East Germany, Hungary, Poland, Romania, and Yugoslavia: Today: Czech.

European Federation of Public Service Unions (EPSU)

Europe. Albania AL Austria Belarus Belgium.

BULGARIA’S EXPERIENCE WITH REGIONAL COOPERATION IN SOUTH-EAST EUROPE Veneta Petrova National Statistical Institute of Bulgaria MGSC, March 2011,

Social Studies: Europe & Russia Lesson 34 Practice & Review

Youth in Action Youth in Action supports providing competencies for young people contributes to the Lisbon strategy builds on the previous.

Computer Class – Summer 20092/21/2016 3:45 AM European Countries Albania Andorra Austria Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Czech.

The countries highlighted in red are the ones you have to label on your map. Note that the borders for Montenegro and Kosovo are not drawn on your map.

Geography Review On Map 1, please identify: -Spain -France -England -Russia -Ottoman empire -Persia -China -Mughal India -Songhai Empire.

Country EPS-12 Total (with ICPS) Hungary7979 Germany5559 Romania3841 Ukraine2527 United Kingdom1930 Finland1842 France1616 Italy1616 Poland1313 Switzerland1314.

The European Law Students’ Association Albania ˙ Austria ˙ Azerbaijan ˙ Belgium ˙ Bosnia and Herzegovina ˙ Bulgaria ˙ Croatia ˙ Cyprus ˙ Czech Republic.

Chapter 8: Cultures of Europe and Russia Section 2: Cultures of Eastern Europe.

Chp 7 Eastern Europe. What is one of Poland’s most important industries?  Coal Mining 204.

South East Europe Transnational Cooperation Programme Beyond the South East Europe Programme.

GF-TADs for Europe Steering Committee meeting EU rabies Projects: Progress report AFSCA - Brussels – 1 October 2015.

France Ireland Norway Sweden Finland Estonia Latvia Spain Portugal Belgium Netherlands Germany Switzerland Italy Czech Rep Slovakia Austria Poland Ukraine.

THE EASTERN EUROPE Can we define it?.

DISTRIBUTION AUTOMATIC - GENERATION

Eastern Europe Includes Albania, Bosnia and Herzegovina, Bulgaria, Croatia, the Czech Republic, Hungary, Macedonia, Poland, Romania, Serbia and Montenegro,

In complete sentences answer the following questions:

Section 1: Northern Europe

Match the Eastern European countries! Russia Hungary Belarus

Намалување на загадувањето на воздухот со електромобилност

European survey respondents by region.

Eastern Europe and Central Asia Brain Drain – Patterns and Issues

Eastern Europe Includes Albania, Bosnia and Herzegovina, Bulgaria, Croatia, the Czech Republic, Hungary, Macedonia, Poland, Romania, Serbia and Montenegro,

H. Un, N. Johnson, A. Vos, T. Muller, A.R. Fooks, O. Aylan

Adriatic Persian Gulf Map Test #1 Answers.

Dr. Ursula Schmedtje ICPDR Secretariat

Global Summit of Women Warsaw, Poland

Adoption, adaptation and applicability of the Global Curriculum in Medical Oncology. Adoption, adaptation and applicability of the Global Curriculum in.

Eastern Europe map test

Adriatic Persian Gulf Map Test #1 Answers.

European representation of respiratory critical care HERMES participants. European representation of respiratory critical care HERMES participants. Countries.

Presentation transcript:

Epidemiology of Rabies in Southeast Europe Nicholas Johnson Rabies and Wildlife Zoonoses Group WHO Collaborating Centre for the Characterization of Rabies and Rabies-Related Viruses

Introduction Rabies is endemic within many countries of south east Europe The fox is the principal reservoir species but dog rabies cases still reported Few epidemiological studies reported from the region Identify factors that contribute to epidemiology Lack of knowledge hampers vaccination programmes

Southeast Europe (the Balkans)

The Balkan Peninsular Poland Russia Czech Republic Ukraine Slovakia Austria Hungary Slovenia Romania Croatia Bosnia and Herzegovina Serbia Bulgaria Mac Albania Greece Turkey

Cohort Details Country (Cases 2005) Fox Dog Jackal Human Other Not recorded [Total] Bosnia-Herzegovina (36) 10 3 4 17 Bulgaria (8) 5 2 1 12 Georgia Serbia & Montenegro (101) Hungary (9) Poland (138) Romania (530) 9 Russia (3087) Slovak Republic (50) Turkey (193) 7 21 75

Isolate details Code No. Country Region Species Year Genbank Accession Number 5 Bulgaria Lovech Fox 2003 DQ300293 1279 Romania Iolomita ? - RV1124 Turkey Manisa 2000 AY091610

Region of the Genome N P M G L 327 nucleotides TTATCGTGGATCAATATGAGTACAAGTACCCTGCCATCAAAGATTTGAAAAAGCCCTGTATAACTCTAGGAAAGGCTCCC GATTTAAATAAAGCATACAAGTCAGTTTTATCATGCATGAGCGCCGCCAAACTTGATCCTGACGATGTATGTTCCTATTT GGCGGCGGCAATGCAGTTTTTTGAGGGGACATGTCCGGAAGACTGGACCAGCTATGGAATCGTGATTGCACGAAAAGGAG ATAAGATCACCCCAGGTTCTCTGGTGGAGATAAAACGTACTGATGTAGAAGGGAATTGGGCTCTGACAGGAGGCATGGAA CTGACAAGAGACCCCAC

Phylogenetic analysis of RABV sequences from Southeastern Europe Bulgaria SAD B19 Eastern Turkey Pasteur Romania Western Turkey Romania / Russia Bosnia-Herzegovina

Phylogenetic tree of Eastern European Isolates Central Romania Wave 1: Western Turkey Western Turkey Bosnia-Herzegovina Outgroup Bulgaria * Eastern Romania / Russia 0.01 substitutions / site * Bootstrap values > 700

Romania Romania / Russia Romania / Poland

Bulgaria Targovishte Dobrich Lovech Montana Pleven Lovech Former Yugoslavia Vidin Montana

Bosnia-Herzegovina Bosnia-Herzegovina Hungary

Conclusions Most isolates fall into the East European group of viruses Geography dominates isolate clustering Topography may play a significant role in preventing spread of fox-rabies The Danube appears to block movement between Romania and Bulgaria Such factors could assist in future vaccination campaigns

Acknowledgements Co-Authors Veterinary Laboratories Agency (UK) AR Fooks FLI-Wusterhausen (Germany) T Muller, C Freuling IDT (Germany) A Vos Etlik CVRI (Turkey) O Aylan H Un Natl. Diag. & Res Vet Inst (Bulgaria) R Valtchovski Inst. Diag. & Animal Health (Romania) M Turcitu F Dumistrescu V Vlad Univ. Sarajevo (Bosnia-Hervegovina) R Velic Vet. Inst. Of Republika of Srpska V Sandrac Funding Defra (UK)