Sec 5.1 / 5.2

One Gene – One Polypeptide Hypothesis early 20 th century – Archibald Garrod physician that noticed that some metabolic errors were found in numerous members in a family alkaptonuria – metabolic disorder where tyrosine is not properly broken down hypothesized that these people had a defective enzyme that usually breaks down tyrosine. He also hypothesized that this enzyme was under the control of a single gene.

1941 – Beadle & Tatum first hypothesized that genes and enzymes are somehow related

Beadle & Tatum Expt Used X-rays to cause bread mold (N. Crassa) to mutate Wild type (Normal): can survive on minimal medium (agar, inorganic salts, glucose and biotin) can synthesize all other molecules they need from these simple molecules (e.g. amino acids and nutrients) Mutant: could not survive on minimal medium could not synthesize amino acids and nutrients they need because of deficit in specific enzymes

examining arginine synthesis precursorornithinecitrulline arginine E1E1 E2E2 E3E3

Beadle & Tatum Expt - 3

Beadle & Tatum Conclusions one mutation corresponded to a change in a single enzyme

As researchers learned more about proteins they made minor revisions to the “one gene-one- enzyme” hypothesis Not all proteins are enzymes (e.g. keratin – structural protein) Some proteins are made up of more than one type of polypeptide, each controlled by a different gene (e.g. Hemoglobin – α and β) More accurately: “one-gene-one-polypeptide”

Central Dogma – the cellular chain of command Transcription Animation

Central Dogma DNA mRNA protein COMPONENTSLOCATIONPROCESS nucleustranscription cytoplasmtranslation

Eukaryotes vs. Prokaryotes Figure 17.3b TRANSCRIPTION RNA PROCESSING TRANSLATION mRNA DNA Pre-mRNA Polypeptide Ribosome Nuclear envelope TRANSLATION TRANSCRIPTION DNA mRNA Ribosome Polypeptide

Transcription Figure 17.7 Promoter Transcription unit RNA polymerase Start point Rewound RNA transcript 3 3 Completed RNA transcript Unwound DNA RNA transcript Template strand of DNA DNA 1 Initiation. After RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis at the start point on the template strand. 2 Elongation. The polymerase moves downstream, unwinding the DNA and elongating the RNA transcript 5  3. In the wake of transcription, the DNA strands re-form a double helix. 3 Termination. Eventually, the RNA transcript is released, and the polymerase detaches from the DNA.

Figure 17.4 DNA molecule Gene 1 Gene 2 Gene 3 DNA strand (template) TRANSCRIPTION mRNA Protein TRANSLATION Amino acid ACC AAACCGAG T UGG U UU G GC UC A Trp Phe Gly Ser Codon

A codon in messenger RNA Is either translated into an amino acid or serves as a translational stop signal Figure 17.5 Second mRNA base UCA G U C A G UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG Met or start Phe Leu lle Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala UAU UAC UGU UGC TyrCys CAU CAC CAA CAG CGU CGC CGA CGG AAU AAC AAA AAG AGU AGC AGA AGG GAU GAC GAA GAG GGU GGC GGA GGG UGG UAA UAG Stop UGA Stop Trp His Gln Asn Lys Asp Arg Ser Arg Gly U C A G U C A G U C A G U C A G First mRNA base (5 end) Third mRNA base (3 end) Glu

The following is the sequence of a bases on the template strand of DNA in the transcription unit 3’ – GGATCAGGTCCAGGCAATTTAGCATGCCCC – 5’ a) Transcribe this sequence into mRNA 5’ – CCUAGUCCAGGUCCGUUAAAUCGUACGGGG – 3’ b) List the order of amino acids Pro - Ser – Pro – Gly – Pro – Leu – Asn – Arg – Thr - Gly

Classwork Section 5.1 (pg. 236) #1-2,4-6 Section 5.2 (pg. 241) #1-3,5-13