UniFrac: Comparing Microbial Communities

Slides:

Advertisements

Similar presentations

Land use, poverty & environment Preliminary findings.

Advertisements

Clostridium difficile Colitis or Dysbiosis. Symbiostasis/Dysbiosis.

The Microbiome and Metagenomics

Instrumenting Genomic Sequence Analysis Pipeline Mothur on Shared Memory Architecture Junqi Yin, Bhanu Rekepalli, Pragneshkumar Patel, Chanda Drennen,

Terminology species data = the measured variables we want to explain (response or dependent variables) environmental data = the variables we use for explaining.

Community Measurements. Indirect Gradient Analysis o Use Importance Values (Sum of Relative Frequency, Rel. Dominance, Rel. Density)

Description & Analysis of community composition. The individualistic hypothesis Henry Gleason.

CHAPTER 53 COMMUNITY ECOLOGY Copyright © 2002 Pearson Education, Inc., publishing as Benjamin Cummings Section D: Biogeographic Factors Affecting the Biodiversity.

Lecture 4 Cluster analysis Species Sequence P.symA AATGCCTGACGTGGGAAATCTTTAGGGCTAAGGTTTTTATTTCGTATGCTATGTAGCTTAAGGGTACTGACGGTAG P.xanA AATGCCTGACGTGGGAAATCTTTAGGGCTAAGGTTAATATTCCGTATGCTATGTAGCTTAAGGGTACTGACGGTAG.

Brock Biology of Microorganisms

Lecture 1. Microorganisms: an overview Chapter 1. Microorganisms and Microbiology Chapter 2. An overview of microbial life. Cell and viral structures DNA.

Rarefaction and Beta Diversity James A. Danoff-Burg Dept. Ecol., Evol., & Envir. Biol. Columbia University.

The Microbiome and Metagenomics

Side Of Play-Doh!!. The variables we tested were… Water pH and conductivity pH of the surrounding soil Tree inventory We measured the soil pH and inventoried.

Calculating Diversity Class 3 Presentation 2. Outline Lecture Class room exercise to calculate diversity indices.

From Metagenomic Sample to Useful Visual Anna Shcherbina 01/10/ Anna Shcherbina Bioinformatics Challenge Day 02/02/2013 From Metagenomic Sample to.

Basic concepts in ordination

Molecular evidence for endosymbiosis Perform blastp to investigate sequence similarity among domains of life Found yeast nuclear genes exhibit more sequence.

Species  OTUs  OPUs  Species  OTUs  OPUs. Rosselló-Mora & Amann 2001, FEMS Rev. 25:39-67 Taxa circumscription depends on the observable characters.

Accurate estimation of microbial communities using 16S tags Julien Tremblay, PhD

Announcements  Pick up your collections by Wed PM.  Q. & A. session Thursday 11 December 11:00 AM in Rm 124 BSE.  Comprehensive final exam, Monday 15.

Multivariate Data Analysis  G. Quinn, M. Burgman & J. Carey 2003.

Components of plant species diversity in the New Zealand forest Jake Overton Landcare Research Hamilton.

Figure S1 The North Sea beach of the Dutch barrier island of Schiermonnikoog (N53°30’ E6°10’). The transect indicates the chronosequence along the developing.

Groundwater microbial communities: high dispersal, weak selection? Michael Strack Supervisors: Grant Hose, Adam Stow, David Nipperess, John Ellis (UTS)

Current Challenges in Metagenomics: an Overview Chandan Pal 17 th December, GoBiG Meeting.

PHYLOGENETIC DIVERSITY Methods and applications Divya B. PK lab, CES, IISc.

Elucidating factors behind pair wise distances discrepancies between short and near full-length sequences. We hypothesized that since the 16S rRNA molecule.

Bioinformatics Curriculum Issues, goals, curriculum.

The Microbiome and Metagenomics

Compositionality and Sparseness in 16S rRNA data Anthony Fodor Associate Professor Bioinformatics and Genomics UNC Charlotte.

Measurement of Biological Diversity: Shannon Diversity Index and Shannon’s Equitability Comparing the diversity found in two or more habitats.

Molecular Forensics Adapting a Case for Two Different Course Levels.

Accurate estimation of microbial communities using 16S tags

Soil Microbiology Group Soil Microbial communities from Puerto Rico rain forest (that decompose switchgrass, sample from Feedstock-adapted consortia SG.

713 Lecture 1 Microbial biogeography and diversity.

Australopithecus feed on seeds and soft fruits ~4.4 Mya (million years ago) until ~2.5 Mya ~2 Mya and persisted for ~1 Myr. Pleistocene Homo erectus Bulbs.

Introducing DOTUR, a Computer Program for Defining Operational Taxonomic Units and Estimating Species Richness Patric D. Schloss and Jo Handelsman Department.

Date of download: 6/23/2016 Copyright © 2016 McGraw-Hill Education. All rights reserved. Pipeline for culture-independent studies of a microbiota. (A)

Date of download: 7/7/2016 Copyright © 2016 McGraw-Hill Education. All rights reserved. Pipeline for culture-independent studies of a microbiota. (A) DNA.

Molecular Ecological Network Analyses (MENA)

PNAS 2012 Alpha diversity: how many species are in each sample?

Figure 1. The relationships of bacterial operational taxonomic unit richness (A) and phylogenetic diversity (B) with aridity index based on 97% sequence.

Multivariate community analysis

VISUALIZING COMPLEX BACTERIAL POPULATIONS IN ANIMAL MODELS

Oral bacterial community dynamics in paediatric patients with malignancies in relation to chemotherapy-related oral mucositis: a prospective study Y.

Α-Diversity metrics: (A) observed operational taxonomic units (OTUs) and (B) phylogenetic diversity (PD whole tree) were greater in the mucosa and tumour.

Microbial diversity was broadly compared across three unique built-environment study sites for 16S rRNA amplicon and shotgun metagenome sequencing. Microbial.

Microbiota and Host Nutrition across Plant and Animal Kingdoms

Robust and reliable DNA typing of soils

Gut microbial diversity of mice in voluntary and forced exercise groups. Gut microbial diversity of mice in voluntary and forced exercise groups. Weighted.

Putative MBTA microbial community sources.

C. Kampmann, J. Dicksved, L. Engstrand, H. Rautelin

OTU and beta-diversity novelty.

Ruth E. Ley, Daniel A. Peterson, Jeffrey I. Gordon Cell

Enterotypes of the distal gut microbial profiles.

Volume 14, Issue 6, Pages (December 2013)

Aboveground and belowground samples showed differences in their bacterial community structures and compositions, while bulk soil and root communities differed.

(A) Box-and-whisker plots illustrate the median, maximum, minimum, and first and third quartiles of the distribution of the number of observed OTUs and.

Belowground microbiome community responses.

Microbial communities of the differently treated mice with lupus cluster separately after treatment. Microbial communities of the differently treated mice.

(A and B) Unweighted (A) and weighted (B) UniFrac clustering of three 16S rRNA hypervariable regions using fragment insertion SATé-enabled phylogenetic.

Bacterial composition of olive fermentations is affected by microbial inoculation. Bacterial composition of olive fermentations is affected by microbial.

Comparison of gut microbiota alpha diversity in different preservatives based on 16S rRNA gene V3-V4 amplicon sequencing. Comparison of gut microbiota.

PCoA plots of subgingival samples with disease classification overlaid

Relative proportions of taxa and UPGMA hierarchical clustering of the mock communities. Relative proportions of taxa and UPGMA hierarchical clustering.

Variations in beta and alpha diversity of gut microbiome bacterial communities in relation to presence of Blastocystis. Variations in beta and alpha diversity.

Variations in beta and alpha diversity of gut microbiome eukaryotic communities explained by presence of Blastocystis. Variations in beta and alpha diversity.

Presentation transcript:

UniFrac: Comparing Microbial Communities Presented by: Donovan Parks

Overview Motivating example Quick look at Bray-Curtis Index (BCI) UniFrac: distance measure, significance test, community tree, sequence jackknifing Contrast BCI and UniFrac

Why compare microbial communities?

Bray-Curtis Index (BCI): Distance Measure Measures the difference in OTU diversity between microbial communities.

BCI: Pros and Cons Pros: Cons: Simple (both conceptually and experimentally) Considers both richness and evenness # OTU in a Community Relative Abundance Cons: All clusters considered equally different

UniFrac: Distance Measure Measures the evolutionary distance between microbial communities

UniFrac: Significance Test Do two communities differ significantly?

UniFrac: Community Distance Matrix

UniFrac: Sequence Jackknifing How does the number and evenness of sequences from each community affect the results?

Weighted UniFrac What about the relative abundance of sequences (i.e., evenness)?

UniFrac: A Practical Look

Final Remarks: BCI vs. UniFrac They are different, equally valid measures! BCI: taxon-based method which considers richness and evenness UniFrac: phylogenetic-based method which considers evolutionary divergence Which to prefer depends on the questions you are trying to answer

Final Remarks: Many Ways to Compare Many richness and evenness measures (e.g., Jaccard, Sörensen) Other phylogenetic distance measures (e.g., TreeClimber) Many interesting and meaningful ways to compare microbial communities: Richness and evenness Evolutionary divergence Functional diversity

References UniFrac: BCI: TreeClimber (source of soil sample example): Lozupone C, Knight R, UniFrac: a New Phylogenetic Method for Comparing Microbial Communities, Appl. Environ. Microbiol., Vol. 71, December 2005. Lozupone C, Hamady M, Knight R, UniFrac - An Online Tool for Comparing Microbial Community Diversity in a Phylogenetic Context, BMC Bioinformatics, Vol. 7, August 2006. Online Tool: http://bmf2.colorado.edu/unifrac/index.psp (excellent help page) BCI: Bray R, Curtis T, An Ordination of the Upland Forest Communities of Southern Wisconsin, Ecological Monographs, Vol. 27, 1957. TreeClimber (source of soil sample example): Schloss PD, Handelsman J, Introducing TreeClimber, a test to compare microbial community structures, Applied and environmental microbiology, Vol. 72, No. 4., April 2006.