Bioinformatics in Molecular Anthropology Using Python Language to Analyze DNA of Primates in order to Study Evolution Chanel Ligon Mentor : Dr. Todd Disotell.

Slides:



Advertisements
Similar presentations
Evidence of Evolutionary Change
Advertisements

How Scientists Determined that Living Things Change Over Time
Vicky Lee.  The Descent of Man “In each great region of the world the living mammals are closely related to the extinct species of the same region. It.
 Paleontology  Physical Anthropology  Developmental Biology  Evolutionary Biology.
LESSON 1: What is Genetic Research? PowerPoint slides to accompany Using Bioinformatics : Genetic Research.
Molecular Phylogeny course: Sequence Information Students: Razick Ahmed Sabry Mehio Wissam Lydakis Apostolos Sathyanara Tejashwari.
By: Valerie Scheirer, Tim Davis, and Aleksandra Kumor.
Anthropology is the study of humankind in all times and places. Focuses on the interconnectedness and interdependence of all aspects of the human experience.
Fossils & Evolution Chapter 41 Ch. 4—Key concepts Systematics is the study of the kinds (diversity) of organisms and of the evolutionary relationships.
Classification of Living Things. 2 Taxonomy: Distinguishing Species Distinguishing species on the basis of structure can be difficult  Members of the.
Plant Molecular Systematics (Phylogenetics). Systematics classifies species based on similarity of traits and possible mechanisms of evolution, a change.
Summer Bioinformatics Workshop 2008 Comparative Genomics and Phylogenetics Chi-Cheng Lin, Ph.D., Professor Department of Computer Science Winona State.
NAOMI RINEHART JULY 2009 GENETICS Human Origin and Evolution.
Introduction to Bioinformatics Spring 2008 Yana Kortsarts, Computer Science Department Bob Morris, Biology Department.
We have shown that: To see what this means in the long run let α=.001 and graph p:
BNFO 235 Lecture 5 Usman Roshan. What we have done to date Basic Perl –Data types: numbers, strings, arrays, and hashes –Control structures: If-else,
Anthropology Unit 1. What is Anthropology? Study of human beings and their relatives everywhere, throughout time. There are many ways in which to do.
How is the amino acid sequence determined?
Human Evolution How did we get here?. Controversy 1871 Darwin published a second book “The Descent of Man” Argued humans are related to African Apes (gorilla.
341: Introduction to Bioinformatics Dr. Natasa Przulj Deaprtment of Computing Imperial College London
Ch 2 The Science of Biology
Genetics Chapter Twelve: The Code of Life 12.1 The Role of DNA in Heredity 12.2 DNA and Technology.
Bioinformatics Sean Langford, Larry Hale. What is it?  Bioinformatics is a scientific field involving many disciplines that focuses on the development.
Introduction to Biology and Populations Ecology JEOPARDY!! Characterstics of LifeLab Skills Ecology OverviewPopulation Structure and Dynamics Population.
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
CSE 6406: Bioinformatics Algorithms. Course Outline
OneWorldInsight.com Human Evolution “A Brief Overview” By Bud Hollowell, Ph.D.
Harlem Children Society Stacia Semple - Midwood HS Kimberly Small - George Washington Carver HS New York University Dr. Todd Disotell / Kirstin Sterner.
Hominid Evolution & Classification
Introduction to Molecular Evolution Level 3 Molecular Evolution and Bioinformatics Jim Provan Page and Holmes: Chapter 1.
Department of Computer Science & Engineering Abstract:. In our time, the advantage of technology is the biggest thing for current scientific works. One.
Copyright © 2005 Brooks/Cole — Thomson Learning Biology, Seventh Edition Solomon Berg Martin Chapter 21 The Evolution of Primates.
Phylogenetic trees: Computer models of evolution Dr Dan Everett CSCI 1210.
1 Genome Evolution Chapter Introduction Genomes contain the raw material for evolution; Comparing whole genomes enhances – Our ability to understand.
ARE THESE ALL BEARS? WHICH ONES ARE MORE CLOSELY RELATED?
Human Genome Project Daniel Ospina Joaquín Llano.
Big Ideas in Biology Unit 1. What are the Big Ideas? They are unifying concepts found in all science – biology, chemistry, earth science, physics These.
KEY CONCEPT Molecular clocks provide clues to evolutionary history.
Genetics 760: Genomic Methods for Genetic Analysis Course Organizer: Jim TAs: Tim
WMU CS 6260 Parallel Computations II Spring 2013 Presentation #1 about Semester Project Feb/18/2013 Professor: Dr. de Doncker Name: Sandino Vargas Xuanyu.
A Tale of Three Lice Joan Sharp and Erin Barley
EB3233 Bioinformatics Introduction to Bioinformatics.
Try this: Write your name without using your thumbs!
Modeling molecular evolution Jodi Schwarz and Marc Smith Vassar College Biol/CS353 Bioinformatics.
Exploring Bioinformatics Careers. Place of Employment: University of Kansas Type of Work: DNA analysis to study the history of human populations and migrations.
Human Origins.
Johnson - The Living World: 3rd Ed. - All Rights Reserved - McGraw Hill Companies Genomics Chapter 10 Copyright © McGraw-Hill Companies Permission required.
Darwin’s Discovery and Chimps and Humans.   BI.7 a. Students know why natural selection acts on the phenotype rather than the genotype of an organism.
Bioinformatics Chem 434 Dr. Nancy Warter-Perez Computer Engineering Dr. Jamil Momand Chemistry & Biochemistry.
Human Evolution Darwin’s Discovery and Chimps and Humans.
Evolutionary Genome Biology Gabor T. Marth, D.Sc. Department of Biology, Boston College
Chapter 26 Phylogeny and Systematics. Tree of Life Phylogeny – evolutionary history of a species or group - draw information from fossil record - organisms.
Optimizing Parallel Programming with MPI Michael Chen TJHSST Computer Systems Lab Abstract: With more and more computationally- intense problems.
THE ORDER OF PRIMATES The forest as the human birthplace.
The Social Sciences Divisions. Quantitative vs. Qualitative Quantitative Numbers Measurable Uses statistical inference WHAT, WHERE, WHEN Qualitative Relies.
Darwin’s Discovery and Chimps and Humans. BI.7 a. Students know why natural selection acts on the phenotype rather than the genotype of an organism. BI.
Opener – 6 minutes ▪ Copy the following the terms & definitions into your notebook: ▪ Archaeology – scientific study of ancient cultures through the examination.
Phylogenetic Trees. An old and controversial question: What is our relationship to the modern species of apes? Consider the following species: gorilla,
Presenter: Bradley Green.  What is Bioinformatics?  Brief History of Bioinformatics  Development  Computer Science and Bioinformatics  Current Applications.
Chapter 1, Section 3: Studying Life. Characteristics of Living Things A universal genetic code Grow and develop stimuli Respond to stimuli in their environment.
Biological Bases of Behavior
Are You a Descendant of Witches?
Human Cells Human genomics
Biological Anthropologist Michael Crawford, PhD
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Exam Practice Look at the picture. It shows the two scientists who discovered the structure of DNA. DNA is found in the nucleus of a cell. It is needed.
Applying principles of computer science in a biological context
Unit Genomic sequencing
The Science of Biology Chapter 1
PROJECT DUE TUESDAY!.
Presentation transcript:

Bioinformatics in Molecular Anthropology Using Python Language to Analyze DNA of Primates in order to Study Evolution Chanel Ligon Mentor : Dr. Todd Disotell Co-Mentor : Christina Bergey NYU Anthropology Department

Bio Informatics Advances in genomic technologies has led to an explosive growth in the biological information. Bioinformatics is the application of information technology to the field of molecular biology.

Purpose/Goals To find the region of Mitochondrial DNA with the most variation in the group of primates Catarrhines. To learn how to use Python script to generate programs that compare base pairs and add up all the differences.

Importance of Mitochondrial DNA vs. Nuclear DNA We use Mitochondrial DNA rather than Nuclear DNA of the body because mitochondrial DNA is maternal. Meaning it comes only from the mother so its much clear the origin of the species. Mitochondrial DNA is much rather used then nuclear DNA because with mitochondrial DNA scientists are able to look within the cells of a living organism and analyze short loops of genetic code. Mitochondrial DNA has also allowed scientists to trace back the evolution and migration of human species.

Catarrhines The group Catarrhini includes Old World monkeys, apes, and, humans, all of which evolved in the Old World tropics. It consist of Old World monkeys, Gibbons, Orangutans, Gorillas, Chimpanzees, and Humans.

Python Script & Language Python script is a substantially powerful dynamic programming language that is used in a large variety of application domains.

Our Program Also the purpose was to learn how to use Python script to generate programs that compare base pairs and add up all the differences in each primate group. The program was created so that it would hold a function to count number of differences in two strings of DNA, generates coordinates for DNA substrings, and also compares DNA in pairs and writes the matrix to a file.

Running the Program Because of the large quantity needed to be compared the program could take up to 24 hours to run. Using a larger computer will help it run much faster.

Results When the programmed finished running and we placed the data into a spreadsheet my inference was correct. The graphs showed variation between each comparison. When we created the program we made a part in which it would ask “What size window would you like to use?” The higher the number you put in the less variation you would find because the DNA as a whole is very similar. The smaller number you put in, for example five hundred, you will get more of a variation because there are less base pairs to look at and compare and also its not such a large bulk.

Importance of Studying DNA It is important to study DNA in order to understand evolution because when analyzing DNA using bioinformatic approaches it reveals a number of interesting patterns in primates and their history.

Conclusion This course helped me understand topics such as computer programming, molecular phylogeny, and data-mining. It also helped me gain a competency in programming in the Python language. In the future we hope to work with different kind of programming languages such as Java. That we may find to be quicker and more efficient.

References python.org linux.org ubuntu.com Connect : Information Technology at NYU Spring/Summer 2008 ; Dr. Todd Disotell, Dr. Anthony Di Fiore The Birth of Complex Cells :Scientific American, April 1996 Science & Society, Human Origins : The molecular perspective, Stoneking, Mark, VOL 9

Acknowledgements Mentor : Dr. Todd Disotell Co-Mentor: Christina Bergey Harlem Children Society Harlem Children Society Staff Dr. Sat Bhattacharya