Endocytosis & Exocytosis By : Matt Sargeant. What is Endocytosis and Exocytosis? Endocytosis is a process by which cells absorb molecules (such as proteins)

Slides:

Advertisements

Similar presentations

Cells: The Living Units: Part B.  Two types of active processes: ◦ Active transport ◦ Vesicular transport  Both use ATP to move solutes across a living.

Advertisements

Bulk Transport/Vessicular Traffic Bulk transport refers to the transport of solutes enclosed in vesicles. Many of these solutes are too large to diffuse.

Lecture 6 - Intracellular compartments and transport I.

Transport Across the Cell Membrane maintains homeostasis of cell membrane is selectively permeable – some things can pass through but others can’t 3 types:

Cell Transport.

OSMOSIS AND DIFFUSION. Objectives 2. Explain how the processes of diffusion, active transport, photosynthesis, and respiration are accomplished in a cell.

Endocytosis & Exocytosis Pooja Patel Elizabeth Pemberton.

Copyright © 2005 Pearson Prentice Hall, Inc. Intracellular Compartments and Transport Membrane Enclosed Organelles Protein Sorting Vesicular Transport.

Cell Transport. The Need For Security The cell membrane controls what may enter or exit the cell. It is semi-permeable – only certain substances may pass.

Cells and Their Environment. Cell membranes – function to communicate between neighboring cells. They also serve as a selectively permeable barrier. It.

Biological Membranes Chapter 5.

A Closer Look at Membranes Chapter 6. Cell Membrane Main Functions Controls Transport in & out of the Cell Cell membrane is selectively- permeable, meaning.

Chapter 5: Homeostasis and Transport

Receptor-Mediated Endocytosis As Presented By Michael Chan.

Cell Transport 1. What is the purpose of the cell membrane? 2. Why would we need to regulate what goes in and out of the cell? 3. What are some things.

Active Transport. Moves molecules from low to high concentration AGAINST a concentration gradient Requires energy, so cell must use ATP.

Cell Boundaries How is a window screen like a cell membrane? What are some things that can pass through a window screen? What are some things that cannot?

Active Transport: Two Types

1 GCCTCAATGGATCCACCACCCTTTTTGGGCA GCCTCAATGGATCCACCACCCTTTTTGGTGCA AGCCTCAATGGATCCACCACCCTTTTTGGTGC AAGCCTCAATGGATCCACCACCCTTTTTGGTG CAAGCCTCAATGGATCCACCACCCTTTTTGGT.

How Cells Exchange Materials. Diffusion The random movement of atoms, molecules and small particles from an area of high concentration to an area of low.

A Closer Look at Cell Membranes  Aim: How do large particles enter and exit cells?  Do Now: Name some molecules/materials that enter and exit the cell.

TRANSPORT ACROSS CELL MEMBRANES Endocytosis and Exocytosis.

3.6 How Do Diffusion And Osmosis Affect Transport Across The Plasma Membrane? Simple diffusion through the phospholipid bilayer Fig. 3-7a Simple diffusion.

Vesicular Transport Pages The general flow of membrane enclosed material within cells.

Active Transport Sometimes cells must move against the concentration gradient- low concentration to areas of high –From areas of low concentration to.

Section 7-3 cont. Active Transport. Requires energy from the cell Requires energy from the cell Moves from low to high concentration Moves from low to.

Chapter 3: Cell Structure and Function

Movements Through Cell Membranes

Active Transport Processes

The building blocks of life

Active Transport Across the Cell Membrane

Cell Membranes.

Types of Transport.

MEMBRANE STUCTURE AND FUNCTION How things get into and out of the cell

The Cell/Plasma Membrane and Cellular Processes

A Closer Look at Cell Membranes

Intracellular Compartments and Transport 2

Biology, 9th ed,Sylvia Mader

Active Transport Sections 5.5 & 5.6.

Intracellular Transport Pathways

Write Cell Transport.

Active Membrane Processes

Bulk Transport Local and Long Distance Signaling

Diffusion and Osmosis.

3 Cells: The Living Units: Part B.

Active Transport Chapter 3, Section 3.

(a) A channel protein Channel protein Solute Carrier protein Solute

Chapter 7.3 Cell Membrane and Cell Transport

CELL MEMBRANE FUNCTION

Transport Conclusion.

Moving across a membrane

Fluid Mosaic Model - Illustrated

Active Transport Active transport: moving molecules in a direction across the concentration gradient. Requires energy Molecular Transport Endocytosis.

3 Cells: The Living Units: Part B.

Active Transport.

Active transport is the pumping ضَخ of solutes against their concentration gradients الإنحدار التركيزي Some facilitated transport proteins can move solutes.

Cell Membrane Structure and Function

EXOCYTOSIS, ENDOCYTOSIS & RECEPTOR MEDIATED ENDOCYTOSIS

Transport Across the Cell Membrane

MEMBRANE STUCTURE AND FUNCTION How things get into and out of the cell

Tracing the Retrograde Route in Protein Trafficking

Active Transport Chapter 7.3.

Bulk Transport.

BOTH require energy from the cell

Chapter 13 Intracellular Vesicular Traffic.

Chapter 8 Membrane Structure & Function

General Animal Biology

General Animal Biology

Presentation transcript:

Endocytosis & Exocytosis By : Matt Sargeant

What is Endocytosis and Exocytosis? Endocytosis is a process by which cells absorb molecules (such as proteins) by engulfing them. It is used by all cells of the body because most substances important to them are large polar molecules that cannot pass through the hydrophobic plasma or cell membrane. Exocytosis - is the durable process by which a cell directs the contents of secretory vesicles out of the cell membrane. These membrane-bound vesicles contain soluble proteins to be secreted to the extracellular environment, as well as membrane proteins and lipids that are sent to become components of the cell membrane.

Endocytosis In endocytosis, the cell engulfs some of its extracellular fluid (ECF) including material dissolved or suspended in it. A portion of the plasma membrane is invaginated and pinched off forming a membrane-bounded vesicles called an endosomes.

Types of Endocytosis Phagocytosis- When the cell engulfs particulate material, such as bacterium or fragments of organic matter.(Cell Eating) Pinocytosis – When the cell engulfs something that is liquid.(Cell Drinking) Receptor Mediated endocytosis – When receptors on the cell membrane bind and then enters the cell, such as with LDL(Low Density Lipoprotein).

Receptor Mediated Endocytosis (RME) 1. Cargo molecules attach to the receptor proteins. 2. The adaptin attaches to the receptor proteins. 3. Clathrin attaches to the adaptin causing invagination. 4. Dynamin pinches off vesicle into the cytosol. 5. Clathrin coat falls off. 6. Travels along microtubules with motor protein towards the negative end to it’s destination. (towards the positive for exocytosis)

Dynamin a large GTPase involved in the scission of nascent vesicles from parent membranes. in_pinchase.mov in_pinchase.mov

Exocytosis The means by which molecules such as proteins, hormones, and waste are secreted from the cell.

synaptotagins The synaptotagmins are a family of proteins with an N- terminal transmembrane domain and two cytoplasmic C2 domains. Many C2 domains mediate calcium-dependent binding to negatively charged membranes. Synaptotagmin-1 is localized to synaptic vesicles and is the trigger for their calcium-induced exocytosis. The two C2 domains of synaptotagmin-1 insert into the membrane upon calcium binding.

Snare proteins SNARE proteins contain motifs that fold into a stable 4 helix bundle pulling the vesicle into close proximity with the plasma membrane 1. Vesicle meets cognate membrane 2. SNAREs engage /Synaptotagmin/SNARE_zip pering.mov /Synaptotagmin/SNARE_zip pering.mov

Snare Engagement 3. SNARE complexes form, and with synaptotagmin membranes undergo fusion via a high curvature intermediate Most intracellular membrane fusion events are SNARE- dependent

Citations and references hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/ /120068/bio02.swf: :Endocytosis%20and%20Exocytosis hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/ /120068/bio02.swf: :Endocytosis%20and%20Exocytosis Snare video snare page dynamin animation