Transcribing Cell Fate: Diabetes Mellitus, Metabolic Memory, and the Role of FOXO3a Megan Kelly, Department of Biology, York College of Pennsylvania Introduction Diabetes can result in reduced life expectancy, increased morbidity, retinopathy, renal disease, and cardiovascular disease (Ceriello et al. 2010, Maiese et al. 2010) “Metabolic memory” is a phenomenon in which the early glycemic environment is remembered by cells in target organs (Ceriello et al. 2010) Oxidative stress is implicated in this process since it persists after normalized glucose levels (Maiese et al. 2010) Hyperglycemia in diabetes causes oxidative stress which leads to the loss of endothelial cells through apoptosis (Hou et al. 2010, Maiese et al. 2010) FOXO transcription factors are associated with cellular damage, survival, differentiation and DNA repair (Carter & Brunet 2007) FOXOs are regulated by the insulin/PI3K/Akt signaling pathway, as shown in Figure 1 (Greer and Brunet 2005, Maiese et al. 2010) Insulin stimulates PI3K which activates Akt and SGK which then activates FOXOs to modulate gene expression (Greer and Brunet 2005, Lam et al. 2006) Akt directly phosphorylates FOXO and promotes cell survival by forcing FOXOs to sequester in the cytoplasm (Lam et al. 2006) SIRT1 deacetylates and represses FOXO function to prevent apoptosis (Greer and Brunet 2005, Lam et al. 2006) FOXO3a is a sensor for cellular stress, is related to high body mass index, insulin resistance, and induces diabetic conditions when phosphorylated (Hou et al. 2010, Maiese et al. 2008) FOXO3a has high expression in neural tissue and initiates a pro-apoptotic program when it moves into the nucleus (Greer and Brunet 2007) Future therapeutic avenues could target FOXO3a activity to limit apoptotic caspases and promote cell survival in diabetes patients (Accili and Arden 2004) Hypothesis  FOXO3a expression will be highest in cells exposed to the highest glucose concentrations (30mM)  FOXO3a expression will be minimal in cells exposed to the lowest glucose concentrations (5mM)  FOXO3a expression will be intermediate in cells exposed to oscillating conditions Results Successful results from Template RNA were reproducible. Results on experimental samples were not reproducible. Conclusions Previous studies have found increases in FOXO expression after high glucose conditions of 25 mM Prior research has also identified the FOXO3a transcription factor as a promising avenue for early, preventative treatment for the metabolic memory phenomenon Since the RT and PCR reactions ran on the template RNA with 18S and Primers was successful, the RT and PCR programs were functional It is probable that the samples had degraded since no repeatable and significant experimental results were obtained Future Studies Repeat the same experiment with new samples Investigate the expression of FOXO3a, FOXO1 and both combined Use RT-PCR on any results to quantify expression of FOXOs Literature Cited Accili, D. and Arden, K.C FoxOs at the crossroads of cellular metabolism, differentiation, and transformation. Cell, 117: Carter, M.E., and Brunet, A FOXO transcription factors. Current Biology, 17(4): Ceriello, A. Ihnat, M.A., and Thorpe, J.E The “metabolic memory”: Is more than just tight glucose control necessary to prevent diabetic complications? Journal of Clinical Endocrinology and Metabolism, 92(2): Greer, E.L. and Brunet, A FOXO transcription factors at the interface between longevity and tumor suppression. Oncogene, 24: Hou, J., Chong, Z.Z., Shang, Y.C., and Maiese, K FOXO3a governs early and late apoptotic endothelial programs during elevated glucose through mitochondrial and caspase signaling. Molecular and Cellular Endocrinology, 321: Lam, E.W.-F., Francis, R.E., and Petkovic, M FOXO transcription factors: key regulators of cell fate. Biochemical Society Transactions, 35(5): Maiese, K. Chong, Z.Z., and Shang, Y.C “Sly as a FOXO”: New paths with forkhead signaling in the brain. Current Neurovascular Research, 4: Maiese, K., Chong, Z.Z., and Shang, Y.C OutFOXOing disease and disability: the therapeutic potential of targeting FoxO proteins. Trends in Molecular Medicine, 14(5): Maiese, K., Shang, Y.C., Chong, Z.Z., and Hou, J Diabetes mellitus: channeling care through cellular discovery. Current Neurovascular Research, 7: Materials and Methods Figure 3. Gel shows a single band with J1 treatment group (30mM glucose 2 weeks, 5mM glucose 1 week) with Primer 6 at approximately 300 base pair. 2% agarose gel run for 20 minutes at 250V. These results were not reproducible. Human ARPE-19 cells maintained in a-MEM and 10% serum Treatments E & F: oscillating glucose, 2-3 days Treatments A & B: 5mMglucose, continuous Treatments C & D: 30mM glucose, continuous Treatments I & J: 30mMglucos e, 2 weeks; 5mM glucose 1 week Treatments G & H: 5mMglucose, 2 weeks; 30mM glucose 1 week RNA quantified using NanoDrop High Capacity cDNA Reverse Transcription Kit used to prepare samples for RT program in ThermoCycler SuperMix and Primers added to cDNA then put into ThermoCycler on PCR program Add H 2 O to all 6 sets of primers to yield 100μM concentration; Table 1 Gel electrophoresis 250V for 20 minutes I would like to thank Dr. Ronald Kaltreider for being my mentor and for his helpful advice and guidance throughout the research process. Figure 2. Gel shows bands produced from Template RNA and Primer 4, Primer 5, and Primer 6, respectively. These results indicate that the primer sets, RT, and PCR were functioning. 2% agarose gel run for 20 minutes at 250V. Figure 1. The regulatory pathway of FOXOs in response to insulin and the cell processes regulated by different environments (Greer and Brunet 2005). PrimerFragment LengthSequence (5' to 3') 1F235CTGAAGGGAAGGAAGCGAGGCG 1R235ACAGGATCGCGGACGGCTCT 2F155CGCGAGCTGACAGGCGGTTC 2R155GCCGCCTCGCTTCCTTCCCTT 3F170AATGTGGAAGGTGGCGGCGC 3R170CCTCGCTTCCTTCCCTTCAGGGA 4F153CGAGCTGACAGGCGGTTCCT 4R153GCCGCTCGCTTCCTTCCCTTC 5F174AGGAATGTGGAAGGTGGCGGC 5R174GCCTCGCTTCCTTCCCTTCAGGGA 6F322GGTGCGTTGCGTGCCCTACT 6R322GCTGCCAGGCCACTTGGAGA Table 1 Primers and expected fragment lengths for FOXO3a