Workpackage 2: Breeding Systems Specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.

Slides:

Advertisements

Similar presentations

Lecture 18, Chapter 11 Analysis of transgenic plants part I

Advertisements

Biotechnology - Using an organism to make a product, …or using advanced methods to study an organism GMO - Genetically Modified Organism Transgenic - describing.

SEXUAL HYBRIDIZATION SANITARY ASPECTS GENETIC TRANSFORMATION EMBRYOGENESIS GENETIC CHARACTERISATION G&H WP2 BREEDING SYSTEMS.

Recombinant DNA Technology

Disease Resistant Transgenic Grapevine Constitutively Expresses Vitis vinifera Thaumatin-like Protein SA Dhekney, ZT Li, MM Van Aman, M Dutt, J Tattersall,

Expression of Cholera toxin B subunit in Banana callus culture Dawn Rivard.

Cloning Promoters Kelli Henry April 27, 2009.

BCM208 Metabolic Biochemistry Topic 7: Gene metabolism and Expression.

Sanitary status Flavour components analysis Flowering fertility assessment Genetic Resources Sexual system - developmental physiology - florogenesis -

Polymerase Chain Reaction - PCR The photocopier of molecular biology.

CHAPTER 31 Genetic Engineering and Biotechnology.

Cloning:Recombinant DNA

Science and GMO-relevant technology Genes and genomes – last week –Genomes and their inheritance and variation –Genes and their structure –Important methods:

1 Review Describe the process scientists use to copy DNA Use Analogies How is genetic engineering like computer programming 2 Review What is a transgenic.

Katie Surckla.  hGM-CSF stands for human Granulocyte- Macrophage Colony Stimulating Factor  hGM-CSF is a cytokine which regulates the production and.

Lecture 18, Chapter 11 Analysis of transgenic plants part I Mat Halter 3/27/12 Plant Genetics, Breeding and Biotechnology (PLSC 452/552), University of.

Lecture 19, Chapter 11 Analysis of transgenic plants part II Neal Stewart.

Analysis of Transgenic Plants. 1.Regeneration on Selective Medium Selectable Marker Gene.

Abstract: In recent years, advances in genetic engineering and techniques of molecular biology have enabled the creation and commercial release of “Genetically.

Recombinant DNA Technology Site directed mutagenesis Genetics vs. Reverse Genetics Gene expression in bacteria and viruses Gene expression in yeast Genetic.

Chapter 13 - Biotechnology

Fig 11-1 Chapter 11: recombinant DNA and related techniques.

DNA Technology n Now it gets real….. O.J. Simpson capital murder case,1/95-9/95 Odds of blood on socks in bedroom not being N. Brown-Simpson’s: 8.5 billion.

Chapter 20~DNA Technology & Genomics. Who am I? Recombinant DNA n Def: DNA in which genes from 2 different sources are linked n Genetic engineering:

-The methods section of the course covers chapters 21 and 22, not chapters 20 and 21 -Paper discussion on Tuesday - assignment due at the start of class.

Genetic Transformation of Plants: Methods and Approaches to Develop Transgenic plants.

Title: Stress-inducible expression of barley Hva1 gene in transgenic mulberry displays enhanced tolerance against drought, salinity and cold stress Journal.

Chapter 18-Genetic Engineering of Plants: Methodology

PLANT VECTORS REKHA PULICHERLA

DNA Cloning and PCR.

By by Enkhchimeg Vanjildorj Supervisor Prof. Lee, Hyo-Yeon College of Applied Life Sciences, Cheju National University, Jeju , Korea College of.

DNA TECHNOLOGY AND GENOMICS CHAPTER 20 P

EBB1, an AP2/ERF Transcription Factor, Promotes Transgenic Shoot Development in Populus Joseph Ree 3/15/12.

Plant Tissue Culture collection of techniques used to maintain or grow plant cells, tissues, or organs under sterile conditions mostly used to produce.

Supplementary Fig. S1 Determination of T-DNA copy number by Southern blot analysis. Fifteen µg genomic DNA of Bintje and mutant nikku were digested with.

European project « 5th PCRDT » GARLIC AND HEALTH Third year progress report Half year meeting Montpellier 1-2 october 2002.

PLANTS TRANSFORMATION Week 7. INTRODUCTION Plants Transformation the introduction of foreign genes into plant cells and the subsequent regeneration of.

Relationship between Genotype and Phenotype

Recombinant DNA What is the basis of recombinant DNA technology? How does one “clone” a gene? How are genetically modified organisms (GMOs) created? Illustration.

Chapter 10 Gene Isolation and Manipulation

Workpackage 2: Breeding Systems specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as.

A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.

Workpackage 2: Breeding Systems

Molecular Cloning. Definitions   Cloning :   Obtaining a piece of DNA from its original source (Genome) and introducing it in a DNA vector   Sub-cloning:

B. Tech. (Biotechnology) III Year V th Semester

Table A. Sequences used in making CsKASII RNAi constructs

2470 bp 1891 bp WT bp 2314 bp A B Fig. S1. Verification with PCR amplification of the.

(A) SGT Antisense RNA construct

DNA Technology and Genomics

Supplemental Figure 1 A) B) C)

Supplemental Figure 2. (A) AtplaIVA-1 and AtplaIVA-2 null transcription lines for AtPLAIVA mRNA. RNAs from the relevant wild type Col were isolated.

Molecular characterisation of Haemophilus influenzae type a and untypeable strains isolated simultaneously from cerebrospinal fluid and blood: novel use.

Agrobacterium Tumefaciens Mediated Gene Transfer

UNIT VII – GENOMICS & CANCER

Transformed explants grown on selective medium Transformation strategy

13-3 Cell Transformation Interactive pgs. 329.

Figure S3 Gui kb a TP b Figure S3 Southern hybridization analysis of hygromycin.

DNA Technology Now it gets real…..

DNA Technology & Genomics

BIO201 Introduction to Biochemistry & Biotechnology

Vav‐1 gene‐targeting strategy.

Volume 5, Issue 1, Pages (July 2015)

Material for Quiz 5 from Chapter 8

GARLIC & HEALTH WP2: breeding Embryogenesis Half year meeting Munich

Establishment of monoclonal SMN2-GFP reporter line in HEK293.

PCR amplification of the ORF encoding the cytosolic p36 protein of M

BAC recombineering, gene targeting and RMCE strategies.

Disruption of the svkA gene encoding severin kinase.

Gene transfer to plants – vectors and strategies

Presentation transcript:

Workpackage 2: Breeding Systems Specific objectives The development of a reliable transformation protocol of garlic using Agrobacterium tumefaciens as a vector Persons involved Si-Jun Zheng, Betty Henken, Frans Krens, Chris Kik (Plant RI, Wageningen, the Netherlands)

Short overview activities 2002 Plant regeneration from non-apical root segment

Short overview activities 2002

Paper with new title: The development of an efficient cultivar independent plant regeneration system from callus derived from both apical and non-apical root segments of garlic (Allium sativum L.) accepted by In Vitro Cell. Dev. Biol. Plant

Development of transformation protocol Transgenic garlic in the greenhouse

Overview activities 2002 A reliable genetic transformation protocol has been developed in garlic

Callus line with GFP expression after selection for 4 months (cv. Printanor ) Analysis of transgenic garlic: GFP

Small garlic shoots with GFP expression after selection for 4 months and regeneration for another 3 months (cv. Printanor)

Analysis of transgenic garlic: GFP Garlic shoot with GFP expression after selection for 4 months and regeneration for another 4 months (cv. Printanor) First GFP plant produced in Plant RI

Analysis of transgenic garlic: standard PCR uid A primers resulting in a 710 bp fragment lane 1-3: transgenic garlic lane 4: negative control lane 5: positive control lane 6: 1kb DNA ladder marker

Cry1Ca primers resulting in a 802 bp fragment lane 1: 1 kb DNA ladder marker lane 2-6: transgenic garlic Analysis of transgenic garlic: standard PCR

PCR amplification of genomic DNA flanking the T-DNA right border after Ssp I digestion lane 1: 1kb DNA ladder marker lane 2: untransformed garlic DNA lane 3: transgenic garlic plant transformed with pCAMBIA1301- Ho4 lane 4: transgenic garlic plant transformed with pCAMBIA1301- Cry1Ca 123 4

Analysis of transgenic garlic: bio-assay Transgenic garlic with Cry1Ca gene is highly resistant to beet armyworm (Spodoptera exigua)

Overview activities 2002

Next steps transformation research Detailed molecular characterisation of the transgenic garlic plants (Southern blot etc.) Writing a paper on garlic transformation Transfer, via genetic modification, a (key)gene from the sulphur metabolic pathway into garlic Shallot ATP sulfurylase is being cloned