RECOMB-BE Dr. Laurie J. Heyer July 20, 2011 Designing and Building a Bacterial Computer

Synthetic Biology Application of engineering principles and mathematical modeling to the design and construction of biological parts, devices, and systems with applications in energy, medicine, environment, and technology. PartsDevicesSystems

Hamiltonian Path Problem Is there a path that: – Starts at node 1 – Ends at node 7 – Visits each node exactly once YES NO

Hamiltonian Path Problem Is there a path that: – Starts at node 1 – Ends at node 7 – Visits each node exactly once YES NO ✔

A Biological Computer Node = gene Edge = 2 half-genes GFPBLaCATCrecFPT7TT 

A Biological Computer Use hin/hix to rearrange edges: Hin recombinase from Salmonella typhimurium

A Biological Computer Use hin/hix to rearrange edges: Hin recombinase from Salmonella typhimurium

Hin Recombinase

Identify Solutions Terminate GFP BLa CATCrecFPT7TT # True Positives = (e - v + 1)! * 2 (e - v + 1) # False Positives = ?

RBS Promoter Reporter Detectable Phenotype Splitting a Gene ✔ hixC RBS Promoter Repo- rter Detectable Phenotype? ✔ hixC RBS Promoter Repo- rter Detectable Phenotype? ✖

GFP displaying hixC insertion point Minimize Structural Disruption

Gene-Splitting Strategy GFP-1GFP-2

Gene Splitting Tool

Note: Oligos are optimized for melting temperatures. Gene Splitter Output

Embed hixC With Silent Mutations hixC = ttatcaaaaaccatggtttttgataa L S K T M V F D X Y Q K P W F L I X I K N H G F * * Find genes with the “best” match to one of: L S K… … V F D a a t Y Q K… … F L I a ^^^^^^^^ t Y Q K … F L I a L S K … V F D a a

Conclusion Synthetic biology is an emerging bioinformatics playground Biology is more efficient with automation Existing tools are insufficient – Learn programming (Perl, Python, etc.) – Learn algorithms and data structures – Think and work across disciplinary boundaries

Acknowledgements Malcolm Campbell (Biology, Davidson College) Todd Eckdahl, Jeff Poet (Missouri Western State Univ.) iGEM ’06 team: Lance Harden, Karmella Haynes, Sabriya Rosemond, Samantha Simpson, Erin Zwack iGEM ’07 team: Oyinade Adefuye, Will DeLoache, Jim Dickson, Andrew Martens, Amber Shoecraft, and Mike Waters Karen Acker ’07 Phillip Compeau ’08 Funding from HHMI, Davidson College, Missouri Western State University, NSF UBM DMS and