From Gene to Protein Chapter 17 - Campbell

What do genes code for? proteins All the traits of the body How does DNA code for cells & bodies?  how are cells and bodies made from the instructions in DNA DNA

The “Central Dogma” Flow of genetic information in a cell – How do we move information from DNA to proteins? transcription translation replication protein RNA DNAtrait

RNA Monomers = nucleotides Phosphate Ribose sugar Nitrogen Bases – uracil instead of thymine U bonds with A C bonds with G single stranded RNADNA transcription

Compare DNA and RNA DNARNA ShapeDouble helix 2 strands Single strand SugarDeoxyriboseRibose BasesA, T, C, and GA, U, C and G LocationOnly in the nucleus Allowed to travel from nucleus to cytoplasm

Types of RNA Ribosomal RNA (rRNA) – Major component of ribosomes Transfer RNA (tRNA) – Folded upon itself – Carries the amino acids to the mRNA Messenger RNA (mRNA) – Sequence of nucleotides that determines the primary sequence of the polypeptide – Made in the nucleus from the DNA: transcription snRNA (small-nuclear “snurps”) – Forms the “spliceosomes” which are used to cut out introns from pre-mRNA siRNA (small-interfering) – targets specific mRNA and prohibits it from being expressed

mRNA Protein Synthesis: From gene to protein DNA transcription nucleuscytoplasm a a a a a a a a a a a protein translation ribosome trait

Fig. 17-3b-3 (b) Eukaryotic cell TRANSCRIPTION Nuclear envelope DNA Pre-mRNA RNA PROCESSING mRNA TRANSLATION Ribosome Polypeptide

Which gene is read on the DNA? Promoter region – binding site before beginning of gene – Generally referred to as a TATA box because it is a repeating sequence of T and A – binding site for RNA polymerase & transcription factors Enhancer region – binding site far upstream of gene Speeds up process

Transcription Factors – transcription factors bind to promoter region of DNA proteins can be activated by hormones (cell signaling) turn on or off transcription – triggers the binding of RNA polymerase to DNA

Fig Promoter Transcription unit Start point DNA RNA polymerase Initiation Unwound DNA RNA transcript Template strand of DNA Elongation Rewound DNA RNA transcript Termination Completed RNA transcript Newly made RNA Template strand of DNA Direction of transcription (“downstream”) 3 end RNA polymerase RNA nucleotides Nontemplate strand of DNA Elongation

Transcription: DNA to mRNA Takes place in the nucleus A section of DNA is unzipped RNA polymerase lays down nucleotides 5’ to 3’ direction. The mRNA then leaves the nucleus through the nuclear pores and enters the cytoplasm

Eukaryotic genes have untranscribed regions! mRNA must be modified before it leaves the nucleus – exons = the real gene expressed / coding DNA – introns = non-coded section in-between sequence Spliceosomes cut out introns with ribozyme eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

Fig Pre-mRNA mRNA Coding segment Introns cut out and exons spliced together 5 Cap Exon Intron ExonIntron 105 Exon Poly-A tail 5 Cap 5 UTR3 UTR 1 146

Fig RNA transcript (pre-mRNA) Exon 1Exon 2Intron Protein snRNA snRNPs Other proteins 5 5 Spliceosome components Cut-out intron mRNA Exon 1 Exon 2 5

Alternative splicing Same piece of DNA can be read many different Not all the exons may make it to the final product Intron presence can determine which exons stay or go Increases efficiency and flexibility of cell snRNA’s have big role in alternative splicing Starting to get hard to define a gene!

A A A A A 3' poly-A tail mRNA 5' 5' cap 3' G P P P A’s Final mRNA processing… Need to protect mRNA on its trip from nucleus to cytoplasm (enzymes in cytoplasm attack mRNA) protect the ends of the molecule add 5 GTP cap add poly-A tail – longer tail, mRNA lasts longer

AAAAAAAAGTP 20-30b 3' promoter transcription stop transcription start introns The Transcriptional unit transcriptional unit (gene) TACACT DNA TATA 5' RNA polymerase pre-mRNA 5'3' translation start translation stop mature mRNA 5'3' exons enhancer b

Genetic Code Genetic code is based on sets of 3 nucleotides …called CODONS! – Read from the mRNA – 64 different possible combinations exist Only 20 amino acids commonly exist in the human body – Some codons code for the same amino acids (degenerate or redundant) Sequence of codons determines the sequence of the polypeptide Code is “almost” universal…same for all organisms (evolutionary heritage)

The Code You don’t need to memorize the codons (except for AUG) Start codon  AUG  methionine Stop codons  UGA, UAA, UAG

AUGCGUGUAAAUGCAUGCGCC mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA mRNA MetArgValAsnAlaCysAla protein ? codon

How is the code “translated?” Process of reading mRNA and creating a protein chain from the code.

Ribosomes: Site of Protein Synthesis Facilitate coupling of tRNA anticodon to mRNA codon Structure – ribosomal RNA (rRNA) & proteins – 2 subunits large small EP A

Ribosomes: 3 binding sites Met 5' U U A C A G A site (aminoacyl-tRNA site) – holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) – holds tRNA carrying growing polypeptide chain E site (exit site) – Empty tRNA leaves ribosome from exit site

Fig Growing polypeptide Exit tunnel Large subunit Small subunit tRNA molecules E P A mRNA 5 3 (a) Computer model of functioning ribosome P site (Peptidyl-tRNA binding site) E site (Exit site) A site (Aminoacyl- tRNA binding site) E P A Large subunit mRNA binding site Small subunit (b) Schematic model showing binding sites Amino end Growing polypeptide Next amino acid to be added to polypeptide chain mRNA tRNA E 3 5 Codons (c) Schematic model with mRNA and tRNA

Fig U U A A C G Met GTP GDP Initiator tRNA mRNA 5 3 Start codon mRNA binding site Small ribosomal subunit 5 P site Translation initiation complex 3 EA Met Large ribosomal subunit

Fig Amino end of polypeptide mRNA 5 3 E P site A site GTP GDP E P A E PA GTP Ribosome ready for next aminoacyl tRNA E P A

Transfer RNA Found in cytoplasm Carries amino acids to ribosome Contains an “anticodon” of nitrogen bases Anticodons use complementary bond with codons Less tRNA’s than codons, so one tRNA may bind with more than one codon. Supports the degenerate code “Wobble” hypothesis: anticodon with U in third position can bind to A or G

Translation: mRNA to Protein In the cytoplasm ribosomes attach to the mRNA – Ribosome covers 3 codons at a time Initiation - The tRNA carrying an amino acid comes into P-site and bonds by base pairing its anti-codon with the mRNA start codon (what is the start codon?) Elongation – The second tRNA then comes into A-site and bonds to codon of mRNA – The two amino acids joined with peptide bond Termination – ribosome continues reading mRNA until a STOP codon is reached (doesn’t code for anything) McGraw Hill Animations

Building a polypeptide Initiation – mRNA, ribosome subunits, initiator tRNA come together Elongation – adding amino acids based on codons Termination – STOP codon = Release factor 123 Leu tRNA Met PEA mRNA 5' 3' U U A A A A C C C AU U G G G U U A A A A C C C A U U G G G U U A A A A C C C A U U G G G U U A A A C C A U U G G G A C Val Ser Ala Trp release factor A AA CC UUGG 3' Good Overview animation

Can you tell the story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA 5' GTP cap poly-A tail large ribosomal subunit small ribosomal subunit EPA 5' 3' RNA polymerase exon intron tRNA

Prokaryote vs. Eukaryote Differences Prokaryotes – DNA in cytoplasm – circular chromosome – naked DNA – no introns – No splicing – Promoter & terminator sequence – Smaller ribosomes Eukaryotes – DNA in nucleus – linear chromosomes – DNA wound on histone proteins – introns and exons – TATA box promoter – Transcription factors present

Transcription & translation are simultaneous in bacteria – Both occur in cytoplasm – no mRNA editing – ribosomes read mRNA as it is being transcribed Protein Synthesis in Prokaryotes