Transcription vs. Translation

Slides:

Advertisements

Similar presentations

RNA and Protein Synthesis

Advertisements

RNA and Protein Synthesis

RNA Transcription.

RNA and PROTEIN SYNTHESIS

Protein Synthesis (Gene Expression). Review Nucleotide sequence in DNA is used to make proteins that are the key regulators of cell functions. Proteins.

Protein Synthesis. Review! What are some functions of proteins? What are some functions of proteins? Enzymes, which speed up chemical reactions Enzymes,

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

VII RNA and Protein Synthesis

Transcription and Translation. What is Transcription? It is a process that produces a complementary strand of RNA by copying a complementary strand of.

Interest Grabber DNA contains the information that a cell needs to carry out all of its functions. In a way, DNA is like the cell’s encyclopedia. Suppose.

Central Dogma DNA RNA Protein. What are chromosomes? Where are they found? Chromosome Histones DNA double helix.

Protein Synthesis 1 Background Information All information is stored in DNA All information is stored in DNA RNA “reads” the DNA code RNA “reads” the.

BELLRINGER: Draw the following box and fill in the squares, THIRD box on the last bell-ringer page: REPLICATIONTRANSCRIPTION Where in the cell.

DNA Replication to Transcription to Translation. DNA Replication Replication : DNA in the chromosomes is copied in the nucleus. DNA molecule is unzipped.

DNA Review  Contains the genetic instructions used in the development and functioning of all organisms  Found in the nucleus of cells!  Made.

RNA and Protein Synthesis. Write these terms in your journal Ribosome — makes proteins Ribosome — makes proteins RNA polymerase — enzyme that puts together.

RNA and Protein Synthesis

Protein Synthesis The majority of genes are expressed as the proteins they encode. The process occurs in 2 steps: 1. Transcription (DNA---> RNA) 2. Translation.

Interest Grabber Information, Please DNA contains the information that a cell needs to carry out all of its functions. In a way, DNA is like the cell’s.

12-3 RNA and Protein Synthesis

RNA Another Nucleic Acid.

DNA can’t do it alone so it

RNA and PROTEIN SYNTHESIS © Pearson Education Inc, publishing as Pearson Prentice Hall. All rights reserved.

RNA & Protein Synthesis. RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins within the cell DNA codes.

Chapter 8: DNA and RNA Section 8-3: RNA. Introductory Question How is the genetic code decoded? What does it say?

RNA & Protein Synthesis. RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins within the cell DNA codes.

Protein synthesis Transcription and translation. fromtoto make up also calledwhich functions toalso called which functions to can be RNA Messenger RNA.

RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.

RNA & Transcription. Contains the genetic instructions used in the development and functioning of all organisms Found in the nucleus of cells! Made up.

RNA and PROTEIN SYNTHESIS 12-3 © Pearson Education Inc, publishing as Pearson Prentice Hall. All rights reserved.

Placed on the same page as your notes Warm-up pg. 48 Complete the complementary strand of DNA A T G A C G A C T Diagram 1 A T G A C G A C T T A A C T G.

RNA and PROTEIN SYNTHESIS 12-3 © Pearson Education Inc, publishing as Pearson Prentice Hall. All rights reserved.

RNA & PROTEIN SYNTHESIS RNA & PROTEIN SYNTHESISRNA & PROTEIN SYNTHESISRNA & PROTEIN SYNTHESIS THE PROCESS OF MAKING PROTEINS MURTAUGH 1B LIVING ENVIRONMENT.

Bell Ringer 1.What is the complementary DNA for the following strand TAC GCA ATG CCT? 2.Where does Protein Synthesis take place (Hint…Unit 3: Cell Organelles)?

Protein Synthesis Making Proteins from DNA. DNA & the Nucleus DNA cannot leave the nucleus! So how can we get the information for making proteins out.

From DNA to Proteins DNAmRNAProtein TranscriptionTranslation.

Chapter 13: RNA and Protein Synthesis Mr. Freidhoff.

RNA and Protein Synthesis. Gene Segment of DNA that specifies the sequence of amino acids in protein.

RNA. RNA RNA: Ribonucleic Acid. Takes info in DNA to create proteins DNA RNA PROTEIN.

RNA and Transcription. Genes Genes are coded DNA instructions that control the production of proteins within the cell To decode the genetic message, you.

G U A C G U A C C A U G G U A C A C U G UUU UUC UUA UCU UUG UCC UCA

Genetics: RNA and Protein Synthesis

CH 12.3 RNA & Protein Synthesis.

RNA Ribonucleic Acid Single-stranded

PROTEIN SYNTHESIS CHAPTER 10 section 4

RNA Another Nucleic Acid.

12-3 RNA and Protein Synthesis

12-3 RNA and Protein Synthesis

RNA Another Nucleic Acid.

12-3 RNA and Protein Synthesis

Biology Unit 4 Notes: RNA & Protein Synthesis

12.3 – RNA and Protein Synthesis

Protein Synthesis.

Transcription and Translation

Protein Synthesis.

Transcription Steps to Transcribe DNA:

Transcription/ Translation Notes 16-17

12-3 RNA and Protein Synthesis

Gene Expression aka Protein Synthesis.

Transcription and Translation

RNA & Protein synthesis

DNA Notes Section 12.3.

Protein Synthesis.

Protein Synthesis Chapter 10.

Protein Synthesis.

Protein Synthesis.

12-3: RNA and Protein Synthesis (part 1)

Presentation transcript:

Transcription vs. Translation Making Proteins

Bring amino acids to ribosome Reviewing RNA Section 12-3 RNA can be Messenger RNA Ribosomal RNA Transfer RNA also called which functions to also called which functions to also called which functions to mRNA Carry instructions rRNA Combine with proteins tRNA Bring amino acids to ribosome from to to make up DNA Ribosome Ribosomes

Transcription RNA polymerase binds to DNA and separates the DNA strand. Then RNA polymerase then uses one strand of DNA as a template from which nucleotides are assembled into a strand of RNA

Transcription Section 12-3 RNA polymerase DNA RNA Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) RNA polymerase DNA RNA

How does RNA read DNA? What is a codon? Three nucleotides How does the RNA know where to start? DNA polymerase only binds to promoters Specific codon that signifies the beginning of a sequence (AUG or methionine) How does the RNA know when to stop? Specific codons that signify the end of a protein chain (there are 3 of them)

Transcription Video Click Here

Transcription Activity The following is a DNA code. Translate them into RNA and then into a protein chain using page 303 in your textbook: DNA= TAC CGA TTA GCG ATG AGT AGA ACT RNA= AUG GCU AAU CGC UAC UCA UCU UGA Start Alanine Asparagine Arginine Tyrosine Serine Serine Stop

Transcription vs. Translation Making Proteins

Bring amino acids to ribosome Reviewing RNA Section 12-3 RNA can be Messenger RNA Ribosomal RNA Transfer RNA also called which functions to also called which functions to also called which functions to mRNA Carry instructions rRNA Combine with proteins tRNA Bring amino acids to ribosome from to to make up DNA Ribosome Ribosomes

Reviewing Transcription Making mRNA from Copying DNA How is it different from DNA Replication? DNA Replication Transcription Copies both strands making 2 new DNA molecules Copies one strand of DNA making 1 mRNA Uses DNA Polymerase Uses RNA polymerase Happens when cell splits Happens all the time

Translation Cell uses information from mRNA to produce proteins tRNA brings amino acids to the mRNA chain Anticodon on tRNA binds to codon on mRNA Amino Acids are bonded to each other in a process called elongation

Section 12-3

Translation Video Click HERE

Activity Transcribe and then Translate the following DNA code into a protein chain. ATTACACCGCATATACTAAC

Homework Explain the entire process for creating a protein (transcriptions and translation) Use the following DNA code to help you: TCTACGCAAAGACCTTAGCATATAACACTTAG Use pictures or drawings to illustrate what is happening in each step Use the following vocab words: RNA polymerase, Codon, Anticodon, Elongation, DNA, mRNA, tRNA, amino aicd, protein