Figure S1: Ma et al., 2015 Supplementary Data 1: Southern blot of three individual plants per generation (T5, T6 and T7), following the digestion of genomic.

Slides:

Advertisements

Similar presentations

20,000 GENES IN HUMAN GENOME; WHAT WOULD HAPPEN IF ALL THESE GENES WERE EXPRESSED IN EVERY CELL IN YOUR BODY? WHAT WOULD HAPPEN IF THEY WERE EXPRESSED.

Advertisements

Transformation/Transfection

Suppl. Fig. S1 Suppl. Fig. S1 The nucleotide sequence and its deduced amino acid sequences of CaSAMDC. The full-length of CaSAMDC (GenBank Accession No.

Lecture 18, Chapter 11 Analysis of transgenic plants part I Mat Halter 3/27/12 Plant Genetics, Breeding and Biotechnology (PLSC 452/552), University of.

Lecture 19, Chapter 11 Analysis of transgenic plants part II Neal Stewart.

Analysis of Transgenic Plants. 1.Regeneration on Selective Medium Selectable Marker Gene.

-The methods section of the course covers chapters 21 and 22, not chapters 20 and 21 -Paper discussion on Tuesday - assignment due at the start of class.

Chapter 18-Genetic Engineering of Plants: Methodology

Lecture 38 Plantibodies.

Downloaded from Lecture40&41 Edible Vaccines.

(A) RdRP 5‘UTR3‘UTR CP MP SP6 (B) (C) 3 dpi 15 dpi (D) Supplementary Figure 1 Infectivity analysis of Nicotiana tabacum. Schematic illustration of the.

FIGURE 7.1. Synthesis of a double-stranded DNA molecule.

Supplementary Fig. S1 Determination of T-DNA copy number by Southern blot analysis. Fifteen µg genomic DNA of Bintje and mutant nikku were digested with.

How to get the cloned gene? (How to clone or identify the gene?) (1) From academic scientist (2) From company (3) PCR (RT-PCR) (4) From DNA library.

Sup. Figure 1 P35S:AtIBH1SRDX P35S:GUS CaMV35S NOS GUS CaMV35S-Ω NOS AtIBH1 SRDX GLDLDLELRLGFA.

Figure S1. Schematic diagram of vector pU1391W used to study subcellular localization of proteins. RB and LB, right and left T-DNA border;; Hpt, hygromycin.

A) EF ATGGACAACTCAGCTCCAGACTCTTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60 HM ATGGACAACTCAGCTCCGGACTCCTTACCTAGATCGGAAACCGCCGTCACCTACGACTCT 60.

Leimgruber et al. Supplementary Figure 1 Supplementary Figure 1. The S’-Y’ and S-Y modules of the HLA-DRA gene exhibit lower levels of H4Ac, reduced nucleosome.

Fire-fly luciferase Light Signal transduction Signals luciferase luciferin Genetic Screens in Arabidopsis: Luciferase screening for gene discovery CCD.

Table A. Sequences used in making CsKASII RNAi constructs

Supplemental Figure 1 A) B) C)

Bacterial Genetic Variation

Stephen Lory, PhD, Jeffrey K. Ichikawa, PhD CHEST

Volume 15, Issue 6, Pages (June 2007)

Karyn Goudie Belanger, Kenneth N Kreuzer Molecular Cell

RNA and Protein Synthesis

by Jian-Min Wang, Hong Zheng, Mila Blaivas, and Kotoku Kurachi

Generation of enhanced stability factor VIII variants by replacement of charged residues at the A2 domain interface by Hironao Wakabayashi, Fatbardha Varfaj,

Consequences of T‐DNA insertion on SWP expression in swp mutant.

Levels of Polyadenylation Factor CstF-64 Control IgM Heavy Chain mRNA Accumulation and Other Events Associated with B Cell Differentiation Yoshio Takagaki,

Base-Pairing between Untranslated Regions Facilitates Translation of Uncapped, Nonpolyadenylated Viral RNA Liang Guo, Edwards M. Allen, W.Allen Miller

Volume 2, Issue 4, Pages (October 1998)

Volume 101, Issue 5, Pages (May 2000)

Silencing in Yeast rDNA Chromatin

Volume 8, Issue 4, Pages (April 2015)

Volume 10, Issue 1, Pages (July 2004)

Transduction of Human Embryonic Stem Cells by Foamy Virus Vectors

Volume 14, Issue 9, Pages (May 2004)

Volume 19, Issue 2, Pages (August 2003)

Fuqing Wu, David J. Menn, Xiao Wang Chemistry & Biology

Volume 9, Issue 5, Pages (May 2016)

Size Polymorphisms in the Human Ultrahigh Sulfur Hair Keratin-Associated Protein 4, KAP4, Gene Family Naoyuki Kariya, Yutaka Shimomura, Masaaki Ito

Karyn Goudie Belanger, Kenneth N Kreuzer Molecular Cell

High Frequency Retrotransposition in Cultured Mammalian Cells

RNA and Protein Synthesis

Supplemental Figure 3 A B C T-DNA 1 2 RGLG1 2329bp 3 T-DNA 1 2 RGLG2

Structure of the GM2A Gene: Identification of an Exon 2 Nonsense Mutation and a Naturally Occurring Transcript with an In-Frame Deletion of Exon 2 Biao.

Volume 18, Issue 2, Pages (April 2005)

Phosphorylation of Serine 2 within the RNA Polymerase II C-Terminal Domain Couples Transcription and 3′ End Processing Seong Hoon Ahn, Minkyu Kim, Stephen.

lin-35 and lin-53, Two Genes that Antagonize a C

Volume 20, Issue 5, Pages (November 2016)

Yingqun Huang, Joan A. Steitz Molecular Cell

Xiuwu Zhang, Chuan-Yuan Li Molecular Therapy

Frpo: A Novel Single-Stranded DNA Promoter for Transcription and for Primer RNA Synthesis of DNA Replication Hisao Masai, Ken-ichi Arai Cell Volume.

Volume 128, Issue 3, Pages (March 2005)

Volume 8, Issue 8, Pages (August 2015)

APOE Gene Targeting (A) Schematic representation of the endogenous APOE locus, the gene targeting vector and the targeted APOE locus. The exons of the.

by Sreenivasulu Chintala, Jian Tan, Rashi Gautam, Michael E

Changes in mutation rate or protein abundance are not observed in HATs when comparing rho+ to rho0 cells. Changes in mutation rate or protein abundance.

MtDNA analysis identifies 8 patients with PS in a cohort of DBA patients. mtDNA analysis identifies 8 patients with PS in a cohort of DBA patients. (A)

Analysis of the 55S peak appearing after repressing the gene for 40S r-protein uS4. Analysis of the 55S peak appearing after repressing the gene for 40S.

Jiamiao Lu, Feijie Zhang, Mark A Kay Molecular Therapy

Three period Homologs in Mammals: Differential Light Responses in the Suprachiasmatic Circadian Clock and Oscillating Transcripts Outside of Brain Mark.

Evidence for Insertional RNA Editing in Humans

Mutation of the Ca2+ Channel β Subunit Gene Cchb4 Is Associated with Ataxia and Seizures in the Lethargic (lh) Mouse Daniel L Burgess, Julie M Jones,

Meiotic DNA Breaks at the S. pombe Recombination Hot Spot M26

A Counterdefensive Strategy of Plant Viruses

Volume 2, Issue 4, Pages (July 2009)

Binding of TCP4-Like Proteins to the SAUR Promoters Is Enhanced by Light Signal or the Lack of PIFs. (A) and (B) Light increases the binding of TCP4 to.

Presentation transcript:

Figure S1: Ma et al., 2015 Supplementary Data 1: Southern blot of three individual plants per generation (T5, T6 and T7), following the digestion of genomic DNA (10 mg per lane) with NcoI and XbaI. Coding sequences for antibody genes were used as the probe (left panel = heavy chain, right panel = light chain).

Figure S2: Ma et al., 2015 Supplementary Data 2: Northern blot of individual plants from three generations (three plants from T5, three from T6 and six plants from T7). Coding sequences for antibody genes were used as probe (left panel = heavy chain transcript, right panel = light chain transcript). RiboRuler High Range RNA ladder (Fermentas) was used as the MW marker.

Figure S3: Ma et al., 2015 Sample Major signals observed (Da)Possible assignment Calculated average chemical mass (Da) P2G12, batch (M-Scan No 1300) 148,6722 x LC + 2 x HC (without CTerm K) + 2 x Hex3HexNAc4FucPent 148, ,7972 x LC + 1 x HC (without CTerm K) + 1 x HC (with CTerm K)+ 2 x Hex3HexNAc4FucPent 148, 795 P2G12, batch (M-Scan No 1301) 148,6772 x LC + 2 x HC (without CTerm K) + 2 x Hex3HexNAc4FucPent 148, ,8012 x LC + 1 x HC (without CTerm K) + 1 x HC (with CTerm K)+ 2 x Hex3HexNAc4FucPent 148,795 Sample UV peak at RT (min) Major signals observed (Da) Possible assignmentsCalculated average chemical mass (Da) P2G12, batch (M-Scan No 1300) ,3221 x LC23, ,0171 x HC (without C- Term K) + 1 x Hex3HexNAc4FucPent 51, ,1451 x HC + 1 x Hex3HexNAc4FucPent 51,152 P2G12, batch (M-Scan No 1301) ,3211 x LC23, ,0161 x HC (without C- Term K) + 1 x Hex3HexNAc4FucPent 51, ,1441 x HC + 1 x Hex3HexNAc4FucPent 51,152 A B Supplementary Data 3: Calculated chemical mass by LC/ES-MS analysis after A) desalting; and B) reduction.

Figure S4: Ma et al., 2015 A B Supplementary Data 4: Peptide mapping obtained from online LC/ES-MS analysis of a reduced/carboxymethylated tryptic digest of sample batches. a) light chain polypeptide; and b) heavy chain polypeptide. Mapped sequences are shown in bold and underlined.

Figure S5: Ma et al., 2015 Monosaccharide P2G12, clinical batch P2G12, pre-clinical batch Mean nmoles/mg 1 Ratio relative to mannose = Mean nmoles/mg 1 Ratio relative to mannose = Fucose Xylose Mannose Galactose Glucose GalNAc ND/ / GlcNAc Supplementary Data 5: Monosaccharide analysis of P2G12.

Suppl. Data 6: Ma et al., 2015 Figure S6: Map of the plant expression vector pTRAp-2G12-Ds. Open reading frames are shown as arrows. Sequences transferred to the plant genome are shown in green. (LB/RB – left and right border of T-DNA from A. tumefaciens Ti-plasmid); Pnos – nopaline synthase gene promoter; pat – Streptomyces hygroscopicus gene for phosphinothricin acetyltransferase; pAnos – nopaline synthase gene polyadenylation signal; SAR – scaffold attachment region of the N. tabacum RB7 gene; P35SS – CaMV 35S promoter with duplicated transcriptional enhancer; TL – 5' untranslated region from Tobacco etch virus; pA35S – CaMV 35S polyadenylation signal; 2G12Hc – 2G12 heavy chain gene, including native signal peptide (SPg); 2G12LC - 2G12 light chain gene, including native signal peptide (SPk); TP Hordeum vulgare GBSSI transit peptide sequence; DsRed – Discosoma spp. red fluorescent protein gene; RK2 ori – origin of replication; bla – b-lactamase gene; ColE1ori – origin of replication.