Presented By: Tim Schellberg & Bruce Budowle ISFG – Krakow, Poland August 31, 2015

These countries have implemented legislation/polices on a national basis to database the DNA of a defined category of criminal offender Australia Austria Bahrain Barbados Belarus Belgium Brazil Canada Czech Republic Chile China Croatia Cyprus Denmark Estonia Finland France Germany Hong Kong Hungary Iceland Israel Japan Jordan Kuwait Latvia Lithuania Netherlands New Zealand Macedonia Malaysia Mauritius Norway Oman Panama Poland Portugal Qatar Russia Slovenia Slovakia Singapore South Korea Spain Sweden Switzerland Taiwan United Arab Emirates United Kingdom United States Uruguay 51 COUNTRIES HAVE IMPLEMENTED NATIONAL PROGRAMS OVER 60 MILLION OFFENDER SAMPLES

Discussion for whole population databases grows in the Middle East Denmark Study: “Nearly 80% say that cataloging the DNA of everyone in the country is a good idea.” -Copenhagen Post February 4, 2015) (February 4, 2015) Changing Attitudes

Decision Factors in Choosing Loci: Less focus on loci’s ability to deal with:  Challenging Casework Samples  Mixtures  Missing Persons/Mass Disasters/War/Dead  Familial Searching <10 STR’s UK in 1995, other early adopters, parts of China STR’s USA and majority of other countries establishing databases after STR’s Existing gold standard What workedWhat worked Preventing adventitious hitsPreventing adventitious hits PrivacyPrivacy Time to resultTime to result Cost ConsiderationCost Consideration

If your goal is to get reliable hits against the database in these situations, what would you rather have in your reference database? Degraded Casework, Mixtures, Missing Persons, Mass Disaster, War Dead, Familial Searching Considerations/Drivers/Barriers: Enhanced Technology necessary to make it practical Enhanced Technology necessary to make it practical What markers should be used? What markers should be used? Quantifying the positive impact on hits Quantifying the positive impact on hits Privacy, policy, legal concerns Privacy, policy, legal concerns

Multiple Technologies  Capillary Electrophoresis Widely used Multiplex analyses  Rapid DNA Typing Instrumentation CE based Provides access by lay individuals  Microarrays  Massively Parallel Sequencing Multiplex analyses Multiplex samples Increased discrimination power

Multiple Technologies  CE and MPS, in particular, offer the potential to add more markers to the toolbox  Current technology can meet needs  Newer technologies provide long term solutions  Need discussions on markers that should be considered to upload into a database With consideration of country legislation

Current Forensic DNA Workflows  CE-based systems are the mainstay of DNA typing Well validated ○ Well understood ○ Robust Well established Cost-effective on a per sample basis No need to batch samples Substantial experience Exploit value of STRs Resource investment already in place Can add more markers to current format

Precedent for Expanded Marker Kits

Made Possible with 6-Dye Configuration

Expand on Theme  Increase number of dyes  Allow for other markers to be multiplexed Selection based on needs and identity testing only  Choice of additional markers

Markers for Possible Expansion  Those that allow better analysis of the bulk of casework New STRs ○ Higher discrimination power ○ Intra-allelic variants Identity SNPs Lineage markers ○ Haploblocks ○ mtDNA ○ Y STRs/SNPs

Types of SNPs  Individual Identification SNPs: SNPs that collectively give very low probabilities of two individuals having the same multisite genotype; individualization, High heterozygosity, low Fst  Ancestry Informative SNPs: SNPs that collectively give a high probability of an individual’s ancestry being from one part of the world or being derived from two or more areas of the world  Lineage Informative SNPs: Sets of tightly linked SNPs that function as multiallelic markers that can serve to identify relatives with higher probabilities than simple di-allelic SNPs  Phenotype Informative SNPs: SNPs that provide high probability that the individual has particular phenotypes, such as a particular skin color, hair color, eye color, etc.  Pharmacogenetic SNPs – molecular autopsy

Indels  Separated by size  Fit well with CE format

Substantial Data on indels

The New Generation of Sequencing Technologies  First generation sequencing technology Sanger Sequencing  Next generation sequencing technologies Roche – 454 SOLiD Illumina – GA II/HiSeq/MiSeq Ion Torrent – PGM, Proton Helicose PacBio Oxford Nanopore Illumina MyGenome App Illumina MiSeq™

Massively Parallel Sequencing Value Backward compatibility with CE-based STR data Large battery of genetic markers can be analyzed simultaneously Autosomal STRs, Y STRs, X STRs, and SNPs (hundreds of markers) mtDNA Barcoding 16 to 384 (in theory) – multiple individuals Economies of scale Can be cost effective on a per marker basis

STR Panel LocusAllele Number of Varying Sequences vWA142 vWA152 vWA162 D3S D3S D8S D8S D8S

Mixture Locus RepeatsCoverage Sequence D2S TCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTA D2S TCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATTTATCTATCTA D2S TCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATTTATCTATCTA D2S TCTATCTATCTATCTATCTATCTATCTATCTATCTGTCTA D2S TCTATCTATCTATCTATCTATCTATCTATCTATCTATCTA Allele 10 from one contributor and stutter (same length of a 10 allele with 80X coverage) from the 11 allele of the other contributor of the two-person mixture.

Minor and Major Contributor Alleles Mixture of 2 people Both 11,12 11 indistinguishable Stutter from allele distinguishable AGAT...AGAT AGAT...AGAG Stutter from allele 12 of the minor contributor

STR Selection Criterion  New STRs with intra-allelic variation  Identifying those markers with more alleles (ideally with similar distributed allele frequencies) can seem sufficient for CE  However, markers containing intra-allelic SNPs that display similarly high heterozygosity are more desirable long term for forensic purposes  Length only approach translates into greater number of alleles with a large size difference Heterozygotes can result in substantial preferential amplification of the smaller sized allele (or drop out of larger allele)  A similarly discriminating locus due to the presence of intra- allelic SNPs could have fewer examples of large size difference for heterozygote alleles Thus may demonstrate less preferential amplification

Privacy, Legal and Legislative Issues – New Technology  CE Technology Enhancements  MPS – Technology Admissibility processes Will MPS be permitted in a compulsory DNA environment? ○ Legislation may develop to highly regulate and restrict MPS from being in the hands of police based government agencies ○ Compare the Stingray Tracking Device

 Additional STRs  Mito  Identity SNPs  Phenotypic and Ancestry SNPs  Y-STRs Privacy, Legal and Legislative Issues – Databasing additional STRs, Mito, ID SNPs, Phenotypic SNPs, Ancestry SNPs and Y-STRs

SNPs with high heterozygosity will not convey significant information about the variations for a Mendelian disorder even if there is complete linkage disequilibrium Very low predictive power Identity SNPs, cont.

Privacy, Legal and Legislative – Phenotypic SNP’s and Ancestry Markers for Criminal Offender Databasing  Little utility to database phenotypic SNPs.  Not practical on a cost benefit basis. IrisPlex: Walsh et al. (2011)

 Existing legal restrictions my already be in place. May not be permitted under USA statute for criminal offeders ○ DNA information must be related to a law enforcement identification purpose - 42 U.S.C (A) (b) (3) (A) May not be permitted under USA Constitution ○ Skinner v. Ry. Labor Executives Assocsaiton (1989) – “Physiological data is a further…invasion of privacy interest” Privacy, Legal and Legislative – Phenotypic SNP’s and Ancestry Markers for Criminal Offender Databasing

Legislation likely to regulate the use of phenotypic and ancestry SNPs, ○ “Appearance” SNPs – Is your race, hair and eye color private? ○ Might be distinction between ancestry SNPs and SNPs that encode facial morphology/pigmentation ○ Some AIMs might be associated with disease genes Requires more effort to determine if there are associations ○ “Sensitive” SNPs (disease, etc.) Will USA Constitution allow for phenotypic and ancestry testing for casework? ○ Traits Exposed to the Public: (USA v. Mara – 1973) ○ Abandonment concepts: California v. Greenwood, 486 U.S. 35 (1988) ○ Abandonment applied to DNA: State v. Athan, Supreme Court of Washington, 5/10/07 – Limited to confirming Identity ○ What will the court do with phenotypic and ancestry SNPs for casework? Unlike STRs, will likely need a warrant. Privacy, Legal and Legislative – Phenotypic, Ancestry SNP’s for CASEWORK

Privacy, Legal and Legislative – Multiple Y-STRs for Criminal Offender Databasing  Impact: Familial searching demand will increase  Consequence: Privacy fears might rise and legislation will increase to regulate familial searching  Recommendations to allow familial searching to continue: Understand and accept opposition’s concerns as a valid point of view Support legislation to limit use, define protocols, and provide for penalties for abuse Develop model protocols for effective use with reduced privacy intrusion

Identical Twins

 Little issue of the SNPs that may differentiate identical twins Unlikely to provide privacy concerns (low predictive power)  No guidance on what to do with whole genome data Destroy data that are identical Protective order on data disclosure ○ Criminal punishment  Defense right to review all data

Conclusions  Casework is changing  Different types of markers may accommodate better the changing landscape of forensic evidence  Technologies exist that enable an increase in the core markers  STRs, Identity SNPs/indels – unlikely to have privacy concerns  Phenotype and ancestry markers should not be considered for entry into a DNA database  Y STRs (and mtDNA) could assist in familial searching  Need to consider legislation and/or model protocols for effective use