Primer Design and Computer Program Does it really matter? Principles of Primer Design Can I trust my gut feeling? What should I do? Sean Tsai ©1999, National Cheng Kung University

Does it Really Matter? A successful PCR is determined primarily by the quality of primer chosen. Examples: --- A single base mismatch at the 3’ end of the primer --- Difference of primer Tm --- Too many homology sequences in the mRNA transcripts 1. Story of monkey progesterone receptor 3. Story of human gonadotropin releasing hormone (GnRH) 2. Story of bovine prostaglandin E2 receptor EP3 subtype

Principles of Primer Design Use the right sequences Optimal length of PCR product Proper length of primer Suitable annealing temperature Avoid hairpin and stem-loop formation Minimize primer self-annealing Other factors: Mg 2+, DNA, dNTP concentrations and

Principles of Primer Design Use the right sequence Beef, pork, chicken, mouse, or rat? Species specific Yes No Consider the length of PCR product Find consensus sequences between different species Sequence Comparison

Principles of Primer Design Optimal length of PCR product B. For probing: bp A. Cloning cDNA:Full length C. Checking Polymorphism: bp D. Quantification: bp E. General: bp Proper restriction sites, Cross intron

Principles of Primer Design Proper length of primer Usually: bases Too short Too long Special considerations: Linkers, Restriction enzyme sites, Complementary to specific sequences

Principles of Primer Design Suitable annealing temperature Depends on primer length and GC content GC content:45-60% Tm: °C Difference in Tm:=< 2°C

Example 471 TCGTTGGATCCCACGGCCAGCCAGCTGCAGGTGCTGCTGGGCGTCCCTGT 520 | ||||| | ||| || | ||| |||| | ||||| || ||| 473 GCCTTGGACCACACAGCTGACAGGCTACAGGCAATCCTGGGTGTTCCTTG GAAGGAGGGAGACTGCACCTCCCGGCTGGACGGACATAAGGTCCTCACTG 570 |||||| |||||||||||||||||||||||||||||||||| ||| 523 GAAGGACAAGAACTGCACCTCCCGGCTGGACGGACACAAGGTCCTGTCTG CCCTGCAGGCTGTTCAGGGCTTGCTGGTCACCCAGGGTGGAAGCAGCAGC 620 ||||||||||||| |||||| |||| || ||||||| | ||| 573 CCCTGCAGGCTGTACAGGGCCTGCTAGTGGCCCAGGGCAGGGCTGATAGC CAGACACCCCTGCTACAGTCCACCGTGGTGGGCCTCTTCACTGCCCCAGG 670 ||| | | ||||| | |||||| ||||||||| | ||||| |||||||| 623 CAGGCCCAGCTGCTGCTGTCCACGGTGGTGGGCGTGTTCACAGCCCCAGG CTTGCGCCTAAAACAGCCATTTGTTGAGAGCTTGGGTCCCTTCACCCCCG 720 | ||| ||| || ||||| ||||| || || ||| || || ||||| | 673 CCTGCACCTGAAGCAGCCGTTTGTGCAGGGCCTGGCTCTCTATACCCCTG 722

Principles of Primer Design (I) A. Avoid hairpin and stem-loop formation B. Minimize primer self-annealing

D. Other factors: Mg 2+, DNA, dNTP concentrations Principles of Primer Design (II) C. Minimizing primer-primer annealing

Can I trust my gut feeling? Eyes vs. computer program

@#*x%# How about pirating other persons primer sequences?

What should I do? Find help from primer designing software! Oligo Synthesis Program: Hillier, L. and Green, P. PCR Methods and Applications, 1: (1991) Oligo 6 (by Wojciech Rychlik): commercially available (National Sciences, Inc) Vector NTI: from MDBio, Inc.

Use Oligo 6 to select primer

What should I do? Design your primer on web site GCG: telnet://gcg.nhri.org.tw Primer 3: genome.wi.mit.edu/cgi- bin/primer/primer3_www.cgi genome.wi.mit.edu/cgi- bin/primer/primer3_www.cgi Seg Web: bin/seqweb.cgi bin/seqweb.cgi

Primer3

Primer3 Output

% prime Prime of what sequence ? ggamma.seq Begin (* 1 *) ? End (* 1700 *) ? 500 Minimum primer length (* 18 *) ? Maximum primer length (* 22 *) ? Minimum product length (* 100 *) ? Maximum product length (* 300 *) ? What should I call the output file name (* ggamma.prime *) ? This program can display the primer binding sites graphically. Do you want to: A) Plot to a FIGURE file called "prime.figure" B) Plot graphics on LaserWriter attached to /dev/tty10 C) Suppress the plot Please choose one (* A *): Searching for forward primers Searching for reverse primers Selecting primer pairs GCG’s Primer Design Command (I)

PRIME of: ggamma.seq ck: 3814 from: 1 to: 500 September 27, :21 INPUT SUMMARY Input sequence: GGamma.Seq Primer constraints: primer size: primer 3' clamp: S primer sequence ambiguity: NOT ALLOWED primer GC content: % primer -: degrees Celsius primer self-annealing... 3' end: < 8 (weight: 2.0) total: < 14 (weight: 1.0) unique primer binding sites: required primer-template and primer-repeat annealing... 3' end: ignored total: ignored repeated sequences screened: none specified Product constraints: product length: product GC content: product Tm: degrees Celsius duplicate primer endpoints: NOT ALLOWED difference in primer Tm: < 2.0 degrees Celsius primer-primer annealing... 3' end: < 8 (weight: 2.0) total: < 14 (weight: 1.0) PRIMER SUMMARY forward reverse Number of primers considered: Number of primers rejected for primer 3' clamp: primer sequence ambiguity: 0 0 primer GC content: primer Tm: non-unique binding sites: 0 0 primer self-annealing: primer-template annealing: 0 0 primer-repeat annealing: 0 0 Number of primers accepted: GCG’s Primer Design Command (II)

PRODUCT SUMMARY Number of products considered: Number of products rejected for... product length: product GC content: 1353 product Tm: 0 product position: 0 duplicate primer endpoints: difference in primer Tm: primer-primer annealing: 7690 Number of products accepted: 1653 Number of products saved: 25 Output for GCG’s Prime (I)

Output of GCG’s Prime (II) Product: 1 [DNA] = nM [salt] = mM PRIMERS ' 3' forward primer (19-mer): 13 TCAGCAGTTCCACACACTC 31 reverse primer (18-mer): 159 TTCTCCTCCAGCATCTTC 142 forward reverse primer %GC: primer Tm (degrees Celsius): PRODUCT product length: 147 product %GC: 51.0 product Tm: 76.8 degrees Celsius difference in primer Tm: 2.0 degrees Celsius annealing score: 37 optimal annealing temperature: 54.9 degrees Celsius

Design a primer pair for human LH receptor First: get the sequence from genebank using the methods you learned from this class before Second: use GCG command mode to do it Third: Use Primer 3 to do it one more time

Human LH receptor mRNA S57793, M73746, M63108, E05678 Genomic DNA: Exon 5: X84760 Accession number: