1 5,466 6,938 bp Forward Primer Reverse Primer zebrafish sorl1 gene Evolution and Expression of an Alzheimer’s Disease Associated Gene, sorl1 in Zebrafish Elizabeth Horst and Dr. Wendy Boehmler Department of Biology, York College of Pennsylvania INTRODUCTION Alzheimer’s Disease (AD) is characterized by the aggregation of senile plaques in the brain that cause deterioration of mental functions. Decreased sorl1 expression has been shown to increase pathogenesis of AD (Rogaeva 2007). Aside from its role in amyloid-ß-peptide plaque recycling, little is known about the role of sorl1 in the brain. Genes involved in neurodegeneration may also play a role in neurodevelopment (Bothwell and Giniger 2000). The advantages to characterizing genes in zebrafish are their rapid development, translucent embryos, large clutches, and the development of in situ hybridization and morpholino knockdown techniques. OBJECTIVES 1) What tissues show sorl1 gene expression in the adult? (Figure 1) 2) What is the evolutionary relationship between the zebrafish sorl1 gene and other organisms’ sorl1 gene? (Table 1) 3) What is the spatio-temporal expression pattern of sorl1 in zebrafish embryos? (Figures 3 & 4) METHODS RESULTS CONCLUSIONS Using PCR it was determined that sorl1 is present in the brain, eye, gut, heart, and muscle tissue of zebrafish. Using bioinformatics, sorl1 was located on chromosome 15 of zebrafish and 11 in humans. These two chromosomes share many similar genes demonstrating synteny. In situ shows where sorl1 is being expressed spatially and temporally in development. FUTURE EXPERIMENT Determine the neurodevelopmental function of sorl1 using morpholino knockdown of sorl1. Insights into the functional role of sorl1 may lead to development of therapeutics for neurodegenerative disorders. REFERENCES Bothwell, M. and E. Giniger Alzheimer’s disease: neurodevelopment converges with neurodegeneration. Cell 102: Rogaeva, E., Meng, Y., Lee, J. H., Gu, Y., Kawarai, T., Zou, F., Katayama, T., Baldwin, C. T., Cheng, R., Hasegawa, H., Chen, F., Shibata, N., Lunetta, K. L., Pardossi-Piquard, R., Bohm, C., Wakutani, Y., Cupples, L. A., Cuenco, K. T., Green, R. C. and L. Pinessi The neuronal sortilin-related receptor sorl1 is genetically associated with Alzheimer disease. Nature Genetics 39: Woods, I. G., Wilson, C., Friedlander, B., Chang, P., Reyes, D. K., Nix, R., Kelly, P. D., Chu, F., Postlethwait, J. H., and W. S. Talbot The zebrafish gene map defines ancestral vertebrate chromosomes. Genome Research 15: Available from: Google scholar. Accessed 2009 March 23. Figure 1. Tissue panel showing RT-PCR results. The primers used were forward (AGTGAAGATGATCCCAGATG) and reverse (CTACGCAATGACCATCGGGAC) primers made for a 900 bp section of the 3’ end of sorl1. This shows that sorl1 is present in brain, eye, gut, heart and muscle tissue. Table 1. Syntenic relationship between human chromosome 11 and zebrafish chromosome 15 supporting an evolutionary link between humans and zebrafish. ACKNOWLEDGEMENTS I thank the Pennsylvania Academy of Science for their generous research grant that is funding this ongoing research. Special thanks to Dr. Wendy Boehmler for her advice and support in this research. 5’ 3’ Brain Eye Gut Heart Muscle Figure 2. p-Drive vector containing a 900 bp fragment of the zebrafish sorl1 gene. Plasmid was linearized and T7 promoter used to synthesize antisense RNA probe for whole-mount in situ hybridization on zebrafish embryos. sorl1 900 bp segment 5’ end at M 13 forward 3’ end at M 13 reverse pDrive Cloning Vector Ampicillin Resistance T7 promoter Collect mRNA from several zebrafish organs use RT-PCR to evaluate where sorl1 is present Clone gene into p-drive vector 900 bp Gene Name Zebrafish Chromosome Human Chromosome sorl11511 mre11a1511 spcs21511 mgc cryab1511 acad81511 hsp or sesn31511 tyr1511 clsc1511 loc In Situ Hybridization -make antisense RNA probe 3’→ 5’ -Antibody probe binds to embryos -series of washes -DIG label on probe Figure 4. Lateral view of a 48 hour embryo. Note the darker staining in the midbrain-hindbrain boundary as well as in the spinal cord. Also notice the absence of staining in the forebrain, midbrain or yolk. E-eye, F-forebrain, M-midbrain, H-hindbrain, Y-yolk, T-tail, MH-midbrain-hindbrain barrier Figure 3. Lateral view of 24 hour embryo. Note the staining in the forebrain, midbrain and hindbrain regions. There is an absence of staining in the yolk or tail. F-forebrain, M-midbrain, H-hindbrain, Y-yolk, T-tail In situ hybridization F M H Y T F M MH H E Y T giving-you-alzheimers-disease/