VII RNA and Protein Synthesis

Slides:



Advertisements
Similar presentations
12-3 RNA and Protein Synthesis
Advertisements

RNA and Protein Synthesis
CH 11.4 & 11.5 “DNA to Polypeptide”.
RNA and Protein Synthesis
End Show Slide 1 of 39 Copyright Pearson Prentice Hall Biology Protein Synthesis: I will understand the general pathway of transcription and translation.
Transcription & Translation Biology 6(C). Learning Objectives Describe how DNA is used to make protein Explain process of transcription Explain process.
RNA and Protein Synthesis
RNA & Protein Synthesis
RNA and Protein Synthesis
10-2: RNA and 10-3: Protein Synthesis
RNA Transcription.
What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.
RNA & Protein Synthesis Intro Genes code DNA instructions that control the production of proteins within the cell. Genes The first step in decoding.
Protein Synthesis The production (synthesis) of polypeptide chains (proteins) Two phases: Transcription & Translation mRNA must be processed before it.
End Show Slide 1 of 39 Copyright Pearson Prentice Hall Biology.
Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.
Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis
RNA. ________ are coded DNA instructions that control the ___________ of proteins. Genetic ______________ can be decoded by copying part of the ___________.
By: Anne Russell, Madelyn Stroder, Hannah Black, And Bailey Mills.
End Show Slide 1 of 39 Copyright Pearson Prentice Hall 12-3 RNA and Protein Synthesis RNA and Protein Synthesis.
The Genetic Code.
RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.
Copyright Pearson Prentice Hall
RNA and Protein Synthesis. Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by copying part of.
End Show Slide 1 of 39 Copyright Pearson Prentice Hall 12-3 RNA and Protein Synthesis 12–3 RNA and Protein Synthesis.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
Question of the DAY Jan 14 During DNA Replication, a template strand is also known as a During DNA Replication, a template strand is also known as a A.
8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule.
RNA and Protein Synthesis Chapter How are proteins made? In molecular terms, genes are coded DNA instructions that control the production of.
Placed on the same page as your notes Warm-up pg. 48 Complete the complementary strand of DNA A T G A C G A C T Diagram 1 A T G A C G A C T T A A C T G.
RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…
1 PROTEIN SYNTHESIS. 2 Protein Synthesis  The production (synthesis) of polypeptide chains (proteins)  Two phases: Transcription & Translation  mRNA.
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
End Show 12–3 RNA and Protein Synthesis Slide 1 of 39 Copyright Pearson Prentice Hall 12–3 RNA and Protein Synthesis 106. What are genes? They are coded.
RNA and Transcription. Genes Genes are coded DNA instructions that control the production of proteins within the cell To decode the genetic message, you.
Notes: Transcription DNA vs. RNA
RNA and Protein Synthesis
CH 12.3 RNA & Protein Synthesis.
PROTEIN SYNTHESIS CHAPTER 10 section 4
RNA & Protein synthesis
Copyright Pearson Prentice Hall
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
From dna to rna.
Protein Synthesis Genetics.
RNA Ribonucleic Acid.
12-3 RNA and Protein Synthesis
What is RNA? Do Now: What is RNA made of?
12-3 RNA and Protein Synthesis
RNA and Protein Synthesis
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
Copyright Pearson Prentice Hall
RNA & Protein synthesis
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
I will understand the general pathway of transcription and translation
12-3 RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
RNA, Protein Synthesis, Transcription, and Translation
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
12-3: RNA and Protein Synthesis (part 1)
Presentation transcript:

VII RNA and Protein Synthesis

Genes, segment of DNA, are coded DNA instructions that control the production of proteins. Genetic messages can be decoded and used in protein synthesis by copying part of the nucleotide sequence from DNA into mRNA. mRNA contains coded information for making proteins.

The Structure of RNA There are three main differences between RNA and DNA: The sugar in RNA is ribose instead of deoxyribose. RNA is generally single-stranded. RNA contains uracil in place of thymine.

Types of RNA There are three main types of RNA: messenger RNA ribosomal RNA transfer RNA

Types of RNA The three main types of RNA are messenger RNA, ribosomal RNA, and transfer RNA. Messenger RNA (mRNA) carries copies of instructions for assembling amino acids into proteins.

Ribosomes are made up of proteins and ribosomal RNA (rRNA). The three main types of RNA are messenger RNA, ribosomal RNA, and transfer RNA. Ribosomal RNA is combined with proteins to form ribosomes. Ribosomes are made up of proteins and ribosomal RNA (rRNA).

Amino acid The three main types of RNA are messenger RNA, ribosomal RNA, and transfer RNA. Transfer RNA During protein construction, transfer RNA (tRNA) transfers each amino acid to the ribosome.

Protein Synthesis DNA molecule DNA strand (template) 3¢ 5¢ TRANSCRIPTION mRNA 5¢ 3¢ Codon TRANSLATION Protein Amino acid

Transcription DNA is copied in the form of RNA This first process is called transcription. The process begins at a section of DNA called a promoter.

RNA RNA polymerase DNA During transcription, RNA polymerase uses one strand of DNA as a template to assemble nucleotides into a strand of RNA.

RNA Editing Some DNA within a gene is not needed to produce a protein. These areas are called introns. The DNA sequences that code for proteins are called exons.

The introns are cut out of RNA molecules. Exon Intron DNA The introns are cut out of RNA molecules. The exons are the spliced together to form mRNA. Pre-mRNA mRNA Many RNA molecules have sections, called introns, edited out of them before they become functional. The remaining pieces, called exons, are spliced together. Then, a cap and tail are added to form the final RNA molecule. Cap Tail

The Genetic Code The genetic code is the “language” of mRNA instructions. The code is written using four “letters” (the bases: A, U, C, and G).

A codon consists of three consecutive nucleotides on mRNA that specify a particular amino acid. A codon is a group of three nucleotides on messenger RNA that specify a particular amino acid.

The Genetic Code The genetic code shows the amino acid to which each of the 64 possible codons corresponds. To decode a codon, start at the middle of the circle and move outward.

Translation Translation is the decoding of an mRNA message into a polypeptide chain (protein) on ribosomes. During translation, the cell uses information from messenger RNA to produce proteins. Nucleus mRNA

The ribosome binds new tRNA molecules and amino acids as it moves along the mRNA and the anticodons of tRNA match the mRNA codons. Lysine Phenylalanine tRNA Methionine Ribosome During translation, or protein synthesis, the cell uses information from messenger RNA to produce proteins. The cell uses all three main forms of RNA during this process. mRNA Start codon

Protein Synthesis Translation direction Lysine tRNA mRNA Ribosome During translation, or protein synthesis, the cell uses information from messenger RNA to produce proteins. The cell uses all three main forms of RNA during this process. mRNA Translation direction Ribosome

The process continues until the ribosome reaches a stop codon. Polypeptide Ribosome tRNA During translation, or protein synthesis, the cell uses information from messenger RNA to produce proteins. The cell uses all three main forms of RNA during this process. mRNA

Amino acids within a polypeptide Codon Codon Codon DNA mRNA Protein Single strand of DNA Codon Codon Codon mRNA This diagram illustrates how information for specifying the traits of an organism is carried in DNA. The sequence of bases in DNA is used as a template for mRNA. The codons of mRNA specify the sequence of amino acids in a protein, and proteins play a key role in producing an organism’s traits. Alanine Arginine Leucine Amino acids within a polypeptide

END OF SECTION