Advisor: Prof. R. C. T. Lee Speaker: T. H. Ku

Slides:



Advertisements
Similar presentations
1 Average Case Analysis of an Exact String Matching Algorithm Advisor: Professor R. C. T. Lee Speaker: S. C. Chen.
Advertisements

Tuned Boyer Moore Algorithm
北海道大学 Hokkaido University 1 Lecture on Information knowledge network2010/12/23 Lecture on Information Knowledge Network "Information retrieval and pattern.
© 2004 Goodrich, Tamassia Pattern Matching1. © 2004 Goodrich, Tamassia Pattern Matching2 Strings A string is a sequence of characters Examples of strings:
Space-for-Time Tradeoffs
Advisor: Prof. R. C. T. Lee Speaker: C. W. Lu
1 The MaxSuffix-Matching Algorithm On maximal suffixes and constant-space versions of KMPalgorithm LATIN 2002: Theoretical Informatics : 5th Latin American.
Boyer Moore Algorithm String Matching Problem Algorithm 3 cases Searching Timing.
1 A simple fast hybrid pattern- matching algorithm Department of Computer Science and Information Engineering National Cheng Kung University, Taiwan R.O.C.
1 Morris-Pratt algorithm Advisor: Prof. R. C. T. Lee Reporter: C. S. Ou A linear pattern-matching algorithm, Technical Report 40, University of California,
Advisor: Prof. R. C. T. Lee Reporter: Z. H. Pan
Advisor: Prof. R. C. T. Lee Speaker: Y. L. Chen
1 The Colussi Algorithm Advisor: Prof. R. C. T. Lee Speaker: Y. L. Chen Correctness and Efficiency of Pattern Matching Algorithms Information and Computation,
1 Reverse Factor Algorithm Advisor: Prof. R. C. T. Lee Speaker: L. C. Chen Speeding up on two string matching algorithms, Algorithmica, Vol.12, 1994, pp
A Fast String Matching Algorithm The Boyer Moore Algorithm.
1 Advisor: Prof. R. C. T. Lee Speaker: G. W. Cheng Two exact string matching algorithms using suffix to prefix rule.
1 Rules in Exact String Matching Algorithms 李家同. 2 The Exact String Matching Problem: We are given a text string and a pattern string and we want to find.
1 String Matching Algorithms Based upon the Uniqueness Property Advisor : Prof. R. C. T. Lee Speaker : C. W. Lu C. W. Lu and R. C. T. Lee, 2007, String.
Boyer-Moore string search algorithm Book by Dan Gusfield: Algorithms on Strings, Trees and Sequences (1997) Original: Robert S. Boyer, J Strother Moore.
1 Rules in Exact String Matching Algorithms 李家同. 2 The Exact String Matching Problem: We are given a text string and a pattern string and we want to find.
1 Two Way Algorithm Advisor: Prof. R. C. T. Lee Speaker: C. C. Yen Two-way string-matching Journal of the ACM 38(3): , 1991 Crochemore M., Perrin.
1 KMP Skip Search Algorithm Advisor: Prof. R. C. T. Lee Speaker: Z. H. Pan Very Fast String Matching Algorithm for Small Alphabets and Long Patterns, Christian,
Smith Algorithm Experiments with a very fast substring search algorithm, SMITH P.D., Software - Practice & Experience 21(10), 1991, pp Adviser:
1 Morris-Pratt Algorithm Advisor: Prof. R. C. T. Lee Speaker: C. W. Lu A linear pattern-matching algorithm, Technical Report 40, University of California,
1 KMP algorithm Advisor: Prof. R. C. T. Lee Reporter: C. W. Lu KNUTH D.E., MORRIS (Jr) J.H., PRATT V.R.,, Fast pattern matching in strings, SIAM Journal.
Quick Search Algorithm A very fast substring search algorithm, SUNDAY D.M., Communications of the ACM. 33(8),1990, pp Adviser: R. C. T. Lee Speaker:
1 The Galil-Giancarlo algorithm Advisor: Prof. R. C. T. Lee Speaker: S. Y. Tang On the exact complexity of string matching: upper bounds, SIAM Journal.
The Zhu-Takaoka Algorithm
Reverse Colussi algorithm
Backward Nondeterministic DAWG Matching Algorithm
1 Boyer and Moore Algorithm Adviser: R. C. T. Lee Speaker: H. M. Chen A fast string searching algorithm. Communications of the ACM. Vol. 20 p.p ,
Raita Algorithm T. RAITA Advisor: Prof. R. C. T. Lee
Algorithms and Data Structures. /course/eleg67701-f/Topic-1b2 Outline  Data Structures  Space Complexity  Case Study: string matching Array implementation.
1 Turbo-BM Algorithm Adviser: R. C. T. Lee Speaker: H. M. Chen Deux méthodes pour accélérer l'algorithme de Boyer-Moore, Théorie des Automates et Applications.,
The Galil-Giancarlo algorithm
1 Exact Matching Charles Yan Na ï ve Method Input: P: pattern; T: Text Output: Occurrences of P in T Algorithm Naive Align P with the left end.
String Matching. Problem is to find if a pattern P[1..m] occurs within text T[1..n] Simple solution: Naïve String Matching –Match each position in the.
1 Speeding up on two string matching algorithms Advisor: Prof. R. C. T. Lee Speaker: Kuei-hao Chen, CROCHEMORE, M., CZUMAJ, A., GASIENIEC, L., JAROMINEK,
Advanced Algorithm Design and Analysis (Lecture 3) SW5 fall 2004 Simonas Šaltenis E1-215b
MCS 101: Algorithms Instructor Neelima Gupta
Exact String Matching Algorithms: A Survey Mehreen Ali, Hina Naz Khan, Shumaila Sayyab, Nadeem Iftikhar Department of Bio-Science Mohammad Ali Jinnah University,
Application: String Matching By Rong Ge COSC3100
MCS 101: Algorithms Instructor Neelima Gupta
Information Retrieval CSE 8337 Spring 2005 Simple Text Processing Material for these slides obtained from: Data Mining Introductory and Advanced Topics.
1 String Matching Algorithms Topics  Basics of Strings  Brute-force String Matcher  Rabin-Karp String Matching Algorithm  KMP Algorithm.
CSG523/ Desain dan Analisis Algoritma
Source : Practical fast searching in strings
COMP261 Lecture 20 String Searching 2 of 2.
13 Text Processing Hongfei Yan June 1, 2016.
String Processing.
Fast Fourier Transform
Knuth-Morris-Pratt algorithm
Boyer and Moore Algorithm
Space-for-time tradeoffs
Boyer and Moore Algorithm
Knuth-Morris-Pratt KMP algorithm. [over binary alphabet]
Adviser: R. C. T. Lee Speaker: C. W. Cheng National Chi Nan University
Chapter 7 Space and Time Tradeoffs
Pattern Matching 12/8/ :21 PM Pattern Matching Pattern Matching
Pattern Matching 1/14/2019 8:30 AM Pattern Matching Pattern Matching.
Space-for-time tradeoffs
Pattern Matching 2/15/2019 6:17 PM Pattern Matching Pattern Matching.
Space-for-time tradeoffs
Knuth-Morris-Pratt Algorithm.
String Processing.
Pattern Matching Pattern Matching 5/1/2019 3:53 PM Spring 2007
Space-for-time tradeoffs
Pattern Matching 4/27/2019 1:16 AM Pattern Matching Pattern Matching
Space-for-time tradeoffs
2019/5/14 New Shift table Algorithm For Multiple Variable Length String Pattern Matching Author: Punit Kanuga Presenter: Yi-Hsien Wu Conference: 2015.
Presentation transcript:

Advisor: Prof. R. C. T. Lee Speaker: T. H. Ku Skip Search algorithm Very Fast String Matching Algorithm for Small Alphabets and Long Patterns, Christian, C., Thierry, L. and Joseph, D.P., Lecture Notes in Computer Science, Vol. 1448, 1998, pp. 55-64 Advisor: Prof. R. C. T. Lee Speaker: T. H. Ku

Skip Search algorithm is an algorithm which solves the string matching problems. Input: a text string T of length n and a pattern string P of length m. Output: all occurrences of P in T.

The Skip Search algorithm consists two phases which are Processing and searching. The Skip Search algorithm uses Rule 4(Two window rule) and Rule 2-2 (1-Suffix Rule) to do the string matching.

the buckets for all characters of the alphabet Preprocessing The Preprocessing phase of the Skip Search algorithm preprocesses the pattern by computing the buckets for all characters of the alphabet. Example: Text string T=GCATCGCAGAGAGTATACAGTACG 0 12 3 4 5 6 7 Pattern string P=GCAGAGAG the buckets for all characters of the alphabet A C G T (6,4,2) (1) (7,5,3,0) φ

Search phase The search phase checks what is the km-th symbol in the text string, where 1≦k ≦n/m. According the symbol to align every identical symbol in the pattern and executes matching. Note that the bucket record every symbols’ location in the pattern. Example: Text string T=aabcdbdabcabc Pattern string P=abcabc, m=6 The 6-th symbol in T is b. Then we align it by the 5-th symbol and executes matching. Then we align it by the 2-th symbol and executes matching. T=aabcdbdabcabc abcabc

the buckets for all characters of the alphabet Full Example Text string T=GCATCGCAGAGAGTATACAGTACG 0 12 34 5 6 7 Pattern string P=GCAGAGAG the buckets for all characters of the alphabet A C G T (6,4,2) (1) (7,5,3,0) Φ

GCATCGCAGAGAGTATACAGTACG 0 1 2 3 4 5 6 7 8 9 1011 12 131415161718 19 20 212223 GCATCGCAGAGAGTATACAGTACG A C G T (6,4,2) (1) (7,5,3,0) φ GCAGAGAG mismatch GCAGAGAG mismatch GCAGAGAG exact match Then we check T[15]=T. Since there is no “T” in the pattern, we check T[23]=G. Then we shift pattern to align T[16…23]. GCAGAGAG

Time Complexity The space and time complexity of the preprocessing phase is O(m+σ)(σ is the number of alphabet.) The Skip Search algorithm has a quadratic worst case time complexity but the expected number of text character inspections is O(n).

References [BM77]    A Fast String Searching Algorithm , Boyer, R. S. and Moore, J. S. , Communication of the ACM , Vol. 20 , 1977 , pp. 762-772 . [HS91]    Fast String Searching , Hume, A. and Sundy, D. M. , Software, Practice and Experience , Vol. 21 , 1991 , pp. 1221-1248 . [MTALSWW92] Speeding Up Two String-Matching Algorithms, Maxime C., Thierry L., Artur C., Leszek G., Stefan J., Wojciech P. and Wojciech R., Lecture Notes In Computer Science, Vol. 577, 1992, pp. 589-600 . [MW94] Text algorithms, M. Crochemore and W. Rytter, Oxford University Press, 1994. [KMP77] Fast Pattern Matching in Strings, D.E. Knuth, J.H. Morris and V.R. Pratt, SIAM Journal on Computing, Vol. 6, No.2, 1977, pp 323-350 . [T92] A variation on the Boyer-Moore algorithm, Thierry Lecroq, Theoretical Computer Science archive, Vol. 92 , No.1, 1992, pp 119-144 . [T98] Experiments on string matching in memory structures, Thierry Lecroq, Software—Practice & Experience archive, Vol. 28, No.5, 1998, pp 561-568 [T92] Tuning the Boyer-Moore-Horspool string searching algorithm, Timo Raita, Software—Practice & Experience archive, Vol. 22, No.10, 1992, pp. 879-884 . [G94] String searching algorithms, G.A. Stephen, World Scientific Lecture Notes Series On Computing, Vol. 3, 1994, pp. 243 .