Inquiry Learning through the World of CSI Phillip B. Danielson Associate Professor Department of Biological Sciences Institute for Forensic Genetics UNIVERSITY OF DENVER Copyright © 2005

Forensic Science and Inquiry Learning n Forensics is applied science that students see as “relevant”. n Observational skills and critical thinking are key. n Forensics is about formulating hypotheses and “doing inquiry”.

Forensic Science in the Classroom...and of course… Kids see it as cool stuff!

Celebrity Endorsements of DNA

The Cool Effect: Don’t get swept away! n I want to study Marine Biology! n That’s great. Why?

Career Choice: The CSI Effect n I want to study Forensic Stuff! n That’s great! Why?

Keeping Your Goals Clear n Crime scenes, police investigators, DNA analysts, fingerprint examiners, ballistics experts, forensic pathologists are all cool but don’t forget …………… – It’s really about inquiry learning !

Forensics: Reality vs. Hollywood Forensic science is about thinking like a geek not being a Hollywood hottie. Geek Geek Geek

DNA: A Child of Violence

n Miescher (1869) DNA is discovered as a component of pus in war wounds. The Crimean War and DNA

It’s All the Same DNA Bill’s DNA

It’s All the Same DNA All people have 23 pairs of chromosomes made of DNA. What makes each of us unique?

It’s All the Same DNA Lets Look just at Chromosomes 1

Can you see any DNA Zoom in still more to see if you can see any DNA.

Even Closer See any DNA Yet? Zoom in still more to see if you can see any DNA.

Even Closer See any DNA Yet? Zoom in still more to see if you can see any DNA. Wow? So this is what all the excitement is about…..

What’s Special about DNA ? n The double helical (twisted spiral) molecule that makes up chromosomes. n Each DNA molecule is a long chain made of multiple links called “g” “a” “t” “c”. n Variations in the order of the links exist between different individuals. n Regardless of tissue source, all genomic DNA from a single individual is identical.

DNA stores Info about You GATC

So there is this stuff called DNA – but what makes each of us genetically unique? Unique DNA Profiles

Short Tandem Repeats (STRs) “DNA Stutters” CCTATCGGGTGTCTGATCGATCGATCGATCTATACCTCGATACCAC GGATAGCCCACAGACTAGCTAGCTAGCTAGATATGGAGGTATGGTG CCTATCGGGTGTCTGATCGATCGATCGATCGATCGATCTATACCTC GGATAGCCCACAGACTAGCTAGCTAGCTAGCTAGCTAGATATGGAG 4 repeat DNA 6 repeat DNA

DNA Always Comes in Pairs 5 Repeats 6 Repeats 4 Repeats Remember these parents?

Even in Children 6 Repeats 4 Repeats 5 Repeats 4 Repeats

Needles in a Haystack ? This is what I’m interested in. This is what’s unique. How can I get enough to study?

CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS DNA from Tiny Sources n Gut Contents of bugs that feed on human blood and skin (lice, mosquitos). n Objects that are in direct contact with the human tissues (licked surfaces, contact lenses, jewelry)

CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS More Small Stuff Dandruff is made of dead skin cells that still contain DNA. The root of a single hair has enough DNA to yield a profile

Gathering DNA Evidence Small amounts of blood might provide DNA CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS

Gathering DNA Evidence CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS Old blood from a parking lot might give you DNA

CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS DNA from Grooming Tools n DNA might be found in a hair brush or a razor.

CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS Possible Sources of DNA?  Spit (gross)  Used Cups  Chewed Gum

CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS Possible Sources of DNA?  Shoes  Hats  Ropes/Ligatures  Glasses

CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS  CRIME SCENE DO NOT CROSS Possible Sources of DNA?  Urine  Feces  Vomit

Kary Mullis (1985) Develops the Polymerase Chain Reaction, PCR (After he was abducted by aliens, Earned frequent flyers miles on LSD trips and nearly did himself in with laughing gas. ) Start of the Modern Era of Molecular Biology

Show me the Money

Yo Xerox! n Copies of the target DNA which is flanked by PCR primers increase exponentially Cycle 1 = 1 Cycle 2 = 2 Cycle 3 = 4 Cycle 4 = 8 Cycle 5 = 16 Cycle 10 = 512 Cycle 15 = 16,384 Cycle 20 = 524,288 Cycle 25 = 16,777,216 Cycle 30 = 536,870,912 Cycle 32 = 2,147,483,648

Polymerase Chain Reaction Primers: Target the piece of DNA to be amplified Taq Polymerase: Makes copies of the DNA

Simple Amplification CCTATCGGGTGTCTGATCGATCGATCGATCGATCTCATATACCTGGTATACGTGTAA GGATAGCCCACAGACTAGCTAGCTAGCTAGCTAGAGTATATGGAGGATATGCACATTPCR Primer

Simple Amplification CCTATCGGGTGTCTGATCGATCGATCGATCGATCTCATATACCTGGTATACGTGTAA GGATAGCCCACAGACTAGCTAGCTAGCTAGCTAGAGTATATGGAGGATATGCACATT Notice that the sequence between the primers is repeated. This type of sequence is often quite variable from one person to the next (i.e., the greater the number of repeats, the larger the PCR product).

Simple Amplification CCTATCGGGTGTCTGATCGATCGATCGATCGATCTCATATACCTGGTATACGTGTAA GGATAGCCCACAGACTAGCTAGCTAGCTAGCTAGAGTATATGGAGGATATGCACATT CCTATCGGGTGTCTGATCGATCGATCGATCGATCGATCGTACTATACCTGGTATACGT GGATAGCCCACAGACTAGCTAGCTAGCTAGCTAGCTAGCATGATATGGAGGATATGCA

PCR: One Technique; 100 Different Flavors

n A Simple Technique with Very Broad Applicability  Screening of blood and tissue samples for low abundance pathogens (HIV).  Screening of animals for breeding purposes, pedegree and ownership.  Identification of new species which cannot be grown in a laboratory.  Tracking the mating behavior of birds.  Recovering molecular tags from commercial products.  Identifying tissue matches between humans prior to organ transplants. DNA, PCR and Inquiry: Your creativity is the only limit

Gel Electrophoresis

Porous Sieving Matrices n Electrophoresis separates DNA using electricity to push them through a sieve made of gel-like chemical.  Mobility is a function of size, i.e., Smaller is faster and Bigger is slower. n It’s like McDonalds on a busy weekend.

Heredity: Passing on your unique DNA. 5 Repeats 6 Repeats 4 Repeats Remember these parents?

Analyzing your unique DNA 6 Repeats 4 Repeats 5 Repeats 4 Repeats

Separating Fragments  The PCR amplification for each person must be run in a separate tube and a separate lane on a gel.  For each gene (locus) humans have either one (homozygous) or two (heterozygous) bands. + Person #1 800 Volts - Person #2 Person #3? ? Repeats 7 3

Separating Mixtures Alleles 3, 6, 7 Possible combinations: 6, 7 and 3, 6 3, 7 and 6, 6 + Mixture #1 800 Volts - Mixture #2 Mixture 6 7 3

Children of the Romanovs

Romanov’s and Friends

Children of the Romanovs

DNA profiles that make each of us unique look at multiple loci Unique DNA Profiles

Homozygous Allele 5,5 Heterozygous Allele 2,4 Allelic Ladder (Shows all possible alleles) DNA left over in wells of the gel. Not part of DNA fingerprint. Smudges are PCR primers left over. Not part of DNA fingerprint. 6 repeat allele 5 repeat allele 4 repeat allele 3 repeat allele 2 repeat allele 1 repeat allele

Probability and the Statistics of DNA profiles Unique DNA Profiles

Each STR has a known frequency in the human population. STR#1 4,6 STR#2 9,9 STR#3 4,4 STR#4 6,12 STR#5 24,38 STR#6 7,15 STR#7 18,18

STR#1 4,6 STR#2 9,9 STR#3 4,4 STR#4 6,12 STR#5 24,38 STR#6 7,15 STR#7 18,18 1/101/151/121/181/161/201/11 1/1501/101/1,8001/32,4001/518,4001/10,368,0001/114,048,000

DNA profiles from the cases that you worked yesterday. Unique DNA Profiles

Homozygous Allele 5,5 Heterozygous Allele 2,4 Allelic Ladder (Shows all possible alleles) DNA left over in wells of the gel. Not part of DNA fingerprint. Smudges are PCR primers left over. Not part of DNA fingerprint. 6 repeat allele 5 repeat allele 4 repeat allele 3 repeat allele 2 repeat allele 1 repeat allele

Case #6 Victim: Stephanie Lecaude (3,6) Suspect: Richard Alverenga (1,4) Victim Profile / Suspect Profile Case #1 Victim: Megan Calmus (3,5) Suspect: Jamal Thompson (2,6) Case #2 Victim: Ruby Lucero (4,5) Suspect: Carlos Lucero (5,6) Case #3 Victim: Brenda Bagroski (2,3) Roommate: Janet Smithers (5,5) Case #4 Victim: Tonya Thompson (6,6) Suspect: Father (unknown) Case #5 Victim: Brian Bevis (2,5) Suspect: Richard Alverenga (1,4)

Final Thoughts Thank you for your attention. Any questions?

Contact Information Phillip B. Danielson University of Denver Department of Biological Sciences 2101 E. Wesley Avenue Rm. 211 Denver, CO Tel: (303)