KEY ROLES OF CELL DIVISION  Reproduction  Growth  Repair  Distribution of genetic material Genome, somatic cells, gametes Chromatin, chromosomes, sister chromatids, centromere

Genetic Material Chromatin Chromosomes Chromatids Centromere

Growth Metabolic activity Chromosomes replicate Centrioles replicate Protein syn.  microtubules CELL CYCLE

colchicine

Single, circular chromosome No mitosis Origin of replication Cell wall extends between mesosomes

Cell Cycle Controls G 0 (nondividing) G 1 (restriction point) G 2 M

Cell Cycle Controls Cyclin: cyclic conc. fluctuations; accum. G 1 & S Cdks: concentration stable, activity changes MPF: maturation promoting factor, acts at the G2 checkpoint triggering mitosis by phosphorylating proteins; breaks down its cyclin

INTERNAL & EXTERNAL CUES Kinetochore messages: anaphase promoting complex (APC) inactive until all kinetochores are attached to spindle. Growth factors: proteins that stimulate cell division. –Platelet derived growth factor –Density dependent inhibition –Anchorage dependence

Cancer: tumor, benign tumor, malignant tumor, metastasis

DNA ERWIN CHARGAFF: analyzed nuclei of many species –Base pairing rules (1:1 ratios) –Concentration of cytosine & guanine equal –Concentration of adenine & thymine equal ROSALIND FRANKLIN & MAURICE WILKINS ‒ X-ray diffraction WATSON & CRICK ‒ DNA Model ‒ Proposed semi conservative replication

Double helix Double strand of nucleotides (deoxyribose, phosphate, nitrogen base) held together by H-bonds Anti-parallel strands Purines: adenine & guanine (double rings) Pyrimidines: thymine & cytosine (single rings) DNA STRUCTURE

NOTE: # of H-bonds between bases, measurements, anti-parallel strands

DNA REPLICATION

DNA REPLICATION Given one strand of DNA, what is the base sequence of the complimentary strand? ACGTTGCAAGCTGACCTGGTCAG

REPLICATION MODELS

MESELSON & STAHL PROVE SEMICONSERVATIVE REPLICATION

DNA has two “heavy” strands DNA is now hybrid; ½ heavy, ½ light

MESELSON & STAHL PROVE SEMICONSERVATIVE REPLICATION Conservative replication proven wrong. Semi-conservative & dispersive still possible (all strands hybrids)

MESELSON & STAHL PROVE SEMICONSERVATIVE REPLICATION After another replication (on “light” medium), semi- conservative replication confirmed (1/2 hybrid & ½ light) Predict the next generation!

DNA replication: - DNA polymerases catalyze the reaction - Hydrolysis of phosphate bonds provides energy

DNA: anti-parallel strands Carbons of deoxyribose numbered 1' - 5' Phosphodiester bonds involve the 3' & 5' carbons One strand runs 5' to 3' The other strand runs 3' to 5'

1. DNA polymerase elongates DNA strands only in the 5' to 3' direction 2. One new strand, the leading strand, can elongate continuously 5' to 3' as the replication fork continues. 3. The other new strand, lagging strand, grows discontinuously in an overall 3' to 5' direction by adding short Okazaki fragments that are built in a 5' to 3' direction. 4. Ligase connects the Okazaki fragments.

Priming DNA Synthesis Polymerase cannot initiate synthesis, it can only add to the end of an already started strand. Primase builds RNA nucleotides into a primer. RNA primer eventually replaced by DNA nucleotides

(topoisomerase)

Summary of DNA Replication Ligase joins Okazaki fragments Lagging strand- discontinuous synthesis – Okazaki fragments Helicase unwinds parental double helix Topoisomerase stabilizes unwound DNA Leading strand, continuous synthesis

DNA REPLICATION & MAINTENANCE DNA Polymerase: enzyme which synthesizes single DNA strand from template DNA (replication) Whole nucleotides are bonded to complementary nucleotides to form each new strand. –Trinucleotides are raw materials (ATP, GTP, TTP, CTP) –2  (high energy bonds) used to accomplish bonding (energy expensive); AMP, GMP,TMP,CMP bonded to each other by DNA polymerase. Other enzymes involved in maintaining DNA structure. –Recognition enzymes (proof reading enzymes) scan DNA molecule to identify atypical or injured DNA –Endonucleases (restriction enzymes) – breaks DNA above & below “atypical” sites. –DNA polymerase – synthesizes single strand segments to replace “damaged” segments. –DNA ligase – binds new segment to old strand.

ENZYMES WHICH MAINTAIN DNA “Scanner” or proofreading enzyme checks DNA for damage Endonuclease (restriction enzyme) cuts DNA DNA Polymerase adds new nucleotides DNA Ligase joins new nucleotides (S-P) links Okazaki fragments

The end-replication problem: Gap left at the 5’ end of each chromosome. Each end gets shorter with every replication Telomeres -short nucleotide sequences at the end of each chromosome. - protect the genes - telomerase, present in germ cells, produces telomeres Humans: TTAGGG

MEIOSIS

Introduction to Heredity Offspring inherit chromosomes Asexual reproduction One parent Offspring identical to parent Sexual reproduction Greater variation Two parents Unique gene combinations

Karyotyping

HUMAN LIFE CYCLE Somatic cells Homologous chromosomes Sex chromosomes Autosomes Gametes Haploid/diploid Fertilization (syngamy) Zygote

Chromosomes replicate once Cell divides twice Homologous (paired, carry different versions of the same genes) chromosomes separate

GENETIC VARIATION INDEPENDENT ASSORTMENT – between homologous chromosomes in Meiosis 1 and nonidentical sister chromatids in Meiosis 2 (n=23  8 million possibilities) CROSSING OVER – between homologous chromosomes during prophase 1 RANDOM FERTILIZATION – between ova and sperm (2 23 x 2 23 = over 70 trillion)

Independent assortment

Crossing over