NAT Standards for Clinical Virology Sally Baylis, NIBSC SoGAT XX, Warsaw June 2007

Standardisation – Clinical Virology NIBSC is working with the UK Clinical Virology Network (CVN) & the Health Protection Agency (HPA) to develop a standardisation programme to provide run controls for diagnostic laboratories NIBSC is working with the UK Clinical Virology Network (CVN) & the Health Protection Agency (HPA) to develop a standardisation programme to provide run controls for diagnostic laboratories

Initial Studies Panels of viruses have been distributed to participating laboratories to select suitable run control formulations, these have included: Panels of viruses have been distributed to participating laboratories to select suitable run control formulations, these have included: Influenza A (H1N1, H3N2) Influenza A (H1N1, H3N2) Influenza B Influenza B Herpes simplex virus (HSV-1 & HSV-2) Herpes simplex virus (HSV-1 & HSV-2) Cytomegalovirus Cytomegalovirus Norovirus GII Norovirus GII

Initial Studies contd. Initial Studies contd. Viruses diluted into virus transport medium & distributed to the participating laboratories Participants requested to test materials using routine extraction & amplification/detection procedures Data is returned electronically to NIBSC for analysis Returned data is used to make decisions on suitable formulations for further evaluation

HCVM Stock Material Used in Phase I Studies Human cytomegalovirus (HCMV), Towne strain was cultured in vitro Human cytomegalovirus (HCMV), Towne strain was cultured in vitro at the West of Scotland Specialist Virology Centre, Glasgow

Analysis of HCMV Results - Phase I VirusDilutionCt Value (copies/ml) Lab BLab CLab DLab ELab F HCMV (1.9 x 10 6 copies/ml) 6.8 x 10 5 copies/ml -ve** (1.1 x 10 5 copies/ml) 4.4 x 10 4 copies/ml -ve** (7.5 x 10 3 copies/ml) 3.5 x 10 3 copies/ml -ve** ExtractionMDxMagNAMDx Qiagen manual Amplification/DetectionProbe Equiv. vol. of sample amplified 16 μl20 μl26.5 μl?? ** Run controls as expected

Results Laboratory F failed to generate Ct values for HCMV distributed in Phase I of the study Laboratory F failed to generate Ct values for HCMV distributed in Phase I of the study Extensive follow up was performed to identify why this and another laboratory using the same assay had unexpected results Extensive follow up was performed to identify why this and another laboratory using the same assay had unexpected results Analysis of reactions on agarose gels revealed that product of the expected size was being amplified Analysis of reactions on agarose gels revealed that product of the expected size was being amplified

Alignment of Towne Strain with TaqMan Probe Assay targets glycoprotein gene of HCMV Assay targets glycoprotein gene of HCMV Analysis of the primer sequences revealed a mismatch in the middle of the reverse primer Analysis of the primer sequences revealed a mismatch in the middle of the reverse primer Analysis of sequence of probe vs Towne strain of HCMV revealed 2 mismatches: Analysis of sequence of probe vs Towne strain of HCMV revealed 2 mismatches: GAGCGCCATCTGTTCCTTGTCGAGCAACATACGACGCACAGGGTCTTGAC TGTCGAGCAGCATACGGCGCA

Evaluation of Candidate Run Controls for Norovirus GII +

Norovirus (previously known as the Norwalk-like viruses) is a common cause of gastroenteritis Norovirus (previously known as the Norwalk-like viruses) is a common cause of gastroenteritis Detection has traditionally relied upon EM Detection has traditionally relied upon EM Two genetic clusters of NoV occur; GI and GII Two genetic clusters of NoV occur; GI and GII Phase I of a study identified a suitable concentration of NoV GII isolate to use as a candidate run control Phase I of a study identified a suitable concentration of NoV GII isolate to use as a candidate run controll Faecal norovirus (GII) sample was obtained Faecal norovirus (GII) sample was obtained Sample was disrupted using glass beads in 10 mM Tris-HCl, pH 7.4 containing 2% FCS, & treatment with chloroform, from which a virus stock was prepared Sample was disrupted using glass beads in 10 mM Tris-HCl, pH 7.4 containing 2% FCS, & treatment with chloroform, from which a virus stock was prepared

Norovirus GII Results Phase I VirusDilutionCt Value Lab ALab BLab CLab D NoV GII * *-ve ExtractionMagNAMDxMagNAMDx Amplification/DetectionProbeSYBRProbe Equiv. vol. of sample amplified 80 μl16 μl10 μl26.5 μl * One or more replicate tested negative

Evaluation of Candidate Run Controls for Norovirus GII This has been distributed to 15 laboratories for This has been distributed to 15 laboratories for on going analysis on going analysis Standards will eventually be -marked Standards will eventually be -marked

Norovirus GII Phase II Lab H failed to detect NoV GII

Future Work Clinical panels have been proposed that include: CSFHSV-1, HSV-2, HCMV, EBV, VZV enterovirus, paraenterovirus TransplantHCMV, EBV, adenovirus GenitalHSV-1, HSV-2, Treponema (ulcer) Eye swabsHSV-1, HSV-2, VZV, adenovirus, Chlamydia

Future Work cont. GastroenteritisNoV, astrovirus RespiratoryInfluenza A (H1, H3), influenza B, parainfluenza, RSV…… Vaginal swabsHSV-1, HSV-2, N. gonorrhoea, M. genitalis, C. trachomatis UrethritisN. gonorrhoea, M. genitalis, C. trachomatis

Proposal Prepare International Standards for HCMV and EBV