The East African Lake Malawi represents one of the largest and most diverse adaptive radiations on earth, with over 700 species of haplochromine cichlid.

Slides:



Advertisements
Similar presentations
Chapter 24 The Origin of Species TOP 5.
Advertisements

Christopher Roberts Supervisor: Dr. Luis Mur (former IBS) and Dr. Ian Armstead (formerly IGER) Institute of Biological, Environmental.
Detecting selection using genome scans
Plant of the day! Pebble plants, Lithops, dwarf xerophytes Aizoaceae
The bonobo genome compared with the chimpanzee and human genomes Kay Pruüfer et al. Nature (June,2012) Presenter: Chia-Ying Chen.
Signatures of Selection
Systematics, Genetics and Speciation Fundamentals of Fish Biology September 10, 2008.
Molecular ecology, quantitative genetic and genomics Dave Coltman + Melissa Gunn, Andrew Leviston, Katie Hartnup & Jon Slate.
Jonathan B. Puritz, Christopher M. Hollenbeck, and John R. Gold Fishing for selection, but only catching bias: library effects in double-digest RAD data.
Evolution of Populations.  Biologists studying evolution often focus on a particular population. Population - a group of individuals of the same species.
AP Biology Speciation Modes. AP Biology *Speciation can take place with or without geographic isolation *Reproductive isolation prevents gene flow between.
How do species occur? Concept 24.2: Speciation can take place with or without geographic separation Speciation can occur in two ways: – Allopatric speciation.
Speciation can occur in two ways: Allopatric Speciation
Maryam Daman UOG.
TGCAAACTCAAACTCTTTTGTTGTTCTTACTGTATCATTGCCCAGAATAT TCTGCCTGTCTTTAGAGGCTAATACATTGATTAGTGAATTCCAATGGGCA GAATCGTGATGCATTAAAGAGATGCTAATATTTTCACTGCTCCTCAATTT.
Chapter 24 The Origin of Species.
Chapter 24 Macroevolution and Speciation. Macroevolution Macroevolution refers to any evolutionary change at or above the species level. Speciation is.
POPULATION GENETIC STRUCTURE AND NATURAL VARIATION OF THE MODEL PLANT, ARABIDOPSIS THALIANA, IN ITS NATIVE SOUTHERN RANGE EXTREME AC Brennan, B Méndez-Vigo,
Copyright © 2009 Pearson Education, Inc.  A species can be defined as a group of organisms whose members can breed and produce fertile offspring, but.
The Origin of Species Chapter 24 BCOR 012 Jan. 31 and Feb. 2, 2011.
Speciation Until recently, over 500 species of cichlid fishes lived in East Africa’s Lake Victoria Copyright © 2009 Pearson Education, Inc.
Discover Biology FIFTH EDITION CHAPTER 19 Speciation and the Origins Of Biological Diversity © 2012 W. W. Norton & Company, Inc. Anu Singh-Cundy Michael.
Landscape genomics in sugar pines (Pinus lambertiana) Exploring patterns of adaptive genetic variation along environmental gradients. Carl Vangestel.
Warm-up List and explain the three ways in which sympatric speciation occurs.
Population Genomics of Coastal California Resident and Anadromous Oncorhynchus mykiss in Scott Creek, CA Devon Pearse Molecular Ecology and Genetic Analysis.
Evolution of Biodiversity
The Origin of Species.  Two basic patterns of evolutionary change can be distinguished –Anagenesis –Cladogenesis.
Patterns of divergent selection from combined DNA barcode and phenotypic data Tim Barraclough, Imperial College London.
CHAPTER 24 ORIGIN OF SPECIES “Macro-evolution”. “A place of genesis” Galapagos (Spanish for Tortoise) “Both in space and time, we seem to be brought somewhat.
Speciation and Macroevolution
WE HAVE THE SEQUENCES AND ID’s so now WHAT’S NEXT.
Thomas D. Kocher Department of Biology BSCI 338K Pigmentation Projects.
5 Evolution and Community Ecology CHAPTER. Black and White, and Spread All Over Zebra mussels and quagga mussels were accidentally introduced into Lake.
Methods  DNA was isolated from blood samples collected at four separate locations.  Samples were Nanodropped to ensure proper concentrations of DNA.
A Galápagos Islands tortoise Millions of species inhabit the Earth. Speciation (the formation of new species) is not a rare event! Macro-evolution Chapter.
Signals of natural selection in the HapMap project data The International HapMap Consortium Gil McVean Department of Statistics, Oxford University.
Bio 7: General Biology II Evolutionary, Organismal, & Ecological Biology Dr. Diane Livio myetudes.org/portal MW 2:30-4:30 (CMS 229)
Morphological Variation and Trophic Partitioning Among Central Mexican Lake Silversides Daniel L. Powell and Kyle R. Piller Southeastern Louisiana University,
Gene flow and speciation. Mechanism for speciation Allopatric speciation Sympatric speciation.
Evolution, Biodiversity, & Population Ecology
Essential knowledge 1.C.1:_

Development of New Species by Evolution
Fig. 2. —The 26 models implemented in this study
Tell me the difference between and all that you know about…
Complex phylogenetic relationships among sand-dwelling Malawi cichlids
Principal component analysis of the GO category composition of all genes in each genome/transcriptome and WGD paralogs. Principal component analysis of.
Introgression of Neandertal- and Denisovan-like Haplotypes Contributes to Adaptive Variation in Human Toll-like Receptors  Michael Dannemann, Aida M.
Combining satellite imagery and machine learning to predict poverty
Volume 26, Issue 24, Pages (December 2016)
Genetics and genomics of psychiatric disease
Lucas J.T. Kaaij, Robin H. van der Weide, René F. Ketting, Elzo de Wit 
The ribozyme approach distinguishes RNA-dependent and RNA-independent functions of lincRNA genes. The ribozyme approach distinguishes RNA-dependent and.
Q-Q plot of observed P values against theoretical P values for factor analysis (red dots) and single gene–based methods (in blue). Q-Q plot of observed.
The Origin of Species Chapter 24
Essential knowledge 1.C.1:_
Genomic Signatures of Selective Pressures and Introgression from Archaic Hominins at Human Innate Immunity Genes  Matthieu Deschamps, Guillaume Laval,
Michal Levin, Tamar Hashimshony, Florian Wagner, Itai Yanai 
Matthieu Foll, Oscar E. Gaggiotti, Josephine T
Segregation distortion in chromosome 3.
Volume 25, Issue 15, Pages (August 2015)
Volume 22, Issue 1, Pages (January 2012)
Narwhal Genome Reveals Long-Term Low Genetic Diversity despite Current Large Abundance Size  Michael V. Westbury, Bent Petersen, Eva Garde, Mads Peter.
Fig. 4 Sequence divergence based on RAD sequences in five scaffolds containing genital QTL candidate genes between parapatric species with diverged genital.
GEOGRAPHIC DISTRIBUTION
Volume 12, Issue 1, Pages (January 2019)
The Genomic Footprints of the Fall and Recovery of the Crested Ibis
Results from a GWAS of prostate cancer in the KP population (8,399 cases and 38,745 controls), highlighting key chromosomal regions. Results from a GWAS.
Introgression of Neandertal- and Denisovan-like Haplotypes Contributes to Adaptive Variation in Human Toll-like Receptors  Michael Dannemann, Aida M.
Fig. 1 Epigenomic and genomic variations between dwarf and normal whitefish species and their reciprocal hybrids. Epigenomic and genomic variations between.
Presentation transcript:

The East African Lake Malawi represents one of the largest and most diverse adaptive radiations on earth, with over 700 species of haplochromine cichlid fish. It is an important model system with which to understand ecological diversification, sexual selection and speciation. Our analyses focused on four sympatric species of the endemic deep-water genus Diplotaxodon (fig. 1), previously found to differ significantly in morphology and male monochromatic nuptial color [1] and proposed as example for sympatric speciation. Introduction Single digest RADseq (SbfI) 50 individuals; ~3.5M reads/ind 5 populations > 8 individuals per pop Methods Genomic differentiation among deep-water cichlid species References The genomic architecture of speciation in the Lake Malawi deep water cichlid genus Diplotaxodon Christoph Hahn & Domino Joyce School of Biological, Biomedical and Environmental Sciences, University of Hull 1.Genner et al MolEcol. 2. Catchen et al MolEcol. 3. Jombart & Ahmed Bioinformatics. 4. Brawand et al Nature. 5. Conesa & Goetz Int. J. Plant Gen. 6. Foll & Gaggiotti Genetics. 7. Coop et al Acknowledgements This is a collaboration with Dr Martin Genner, and is funded by NERC grant number NE/K000829/1. Principal data processing using STACKS [2], adegenet [3] and custom scripts ( Genome scans are based on the recently published genome of Metriaclima zebra [4]. Functional annotation of genes obtained using Blast2GO [5]. Fig. 2: Number of candidate outlier loci identified using STACKS [1], BayeScan [6], and Bayenv2 [7].. Fig. 1: Principal component analysis (PCA) based on > 25,000 SNPs, differentiating the 4 putative Diplotaxodon species.. We used Principal component 1 (PC1) scores from [1] as a proxy to specifically identify genomic regions associated with morphological differentiation between species. Normalized PC1 scores were used as ‘environmental factors’ in Bayenv2 [7]. Fig 3: Transformed bayes factor ranks averaged across 10 independent Bayenv2 runs. The vertical red line delimits the 95 th average rank percentile as threshold for candidate loci. The inset shows the species wide PC1 scores [1] used as ‘environmental factors’ in the analyses. Fig 4: (A-F) Pairwise divergence (F ST ) across three selected scaffolds. Displayed are observed values and kernel smoothed averages. Red dots represent candidate outlier loci identified by STACKS (p < 5e -7 ). Y axes range 0 < F ST < 1. (A) Di_1 vs Di_2; (B) Di_1 vs Di_4; (C) Di_1 vs Di_5; (D) Di_2 vs Di_4; (E) Di_2 vs Di_5; (F) Di_4 vs Di_5. (G) Average transformed ranks inferred from the ‘morphology informed’ Bayenv analyses (fig. 3). Red dots represent average ranks in the 95 th percentile. D. limnothrissa black pelvic (Di_2) D. macrops black dorsal (Di_1) D. macrops ngulube (Di_5) D. macrops offshore (Di_4) A B C D E F G Fig. 4 (contd): Rectangles at the bottom represent genes within 15kb windows of candidate outlier SNPs (craniofacial- or eye development). X axes scale: 100kb/tick.