NIRT: Actively Reconfigurable Nanostructured Surfaces for the Improved Separation of Biological Macromolecules Ravi Kane, Steve Granick, and Sanat Kumar, Grant Novelty: Actively reconfigurable nanostructures to control biomolecule adsorption and transport. This biologically-inspired approach seeks to implement, in the bioseparations context, the concept of lipid rafts. Transformative potential: The field of bio-separations is limited by use of passive surfaces. Our goal here is to remove this limitation. To accomplish this task, fundamental underpinnings are under development, those needed to design reconfigurable nanostructured surfaces that enable the separation of biomolecules in a manner that is far more facile and efficient than conventional strategies. Potential Impact on Industry and Society: The understanding of biomolecule recognition and transport provided by this work will impact the design of novel technologies for biosensing, bioseparation, drug delivery, as well as the design of novel therapeutics. The project will also contribute to the training of graduate, undergraduate, and high school students and expose them to a stimulating interdisciplinary research environment. Novel materialsTransportRaft-mimetic bilayers A Epifluorescence tracking of naked GUVs (top) and microsphere adsorbed GUVs (bottom) reveal binding induced charge separation and slaved motion of lipids. 5µm a b c DMPC DMTAP + Before particle binding After binding Lipids diffusion slaved by particle - Enhanced cooperative binding Particle binding induces DMTAP segregation at liquid phase C DMTAP 15%→50% Isothermal titration calorimetry measures the binding energy quantitatively and shows that binding induces charge separation and facilitates further binding Advance made here: particle binding induces segregation of lipid in membrane and gathers their reins In progress: coupled diffusion of lipids and particles Random walkers on a fluctuating lipid tube Particle binding induces charge separation and slaved motion For Corrugated Surfaces D~N -1 Model Chain Diffusion on Surfaces For Smooth Surfaces D~N -3/4 Experiments Show D~N -3/2 Include Surface Defects to Explain Data Transition to experimental data when defect spacing is less than chain size Advance made here: cationic nanoparticles stabilize phospholipid vesicles up to dense volume fractions without fusion, allowing ligand- receptor binding. In progress: interactions with DNA, especially plasmid DNA. NIRT- supported publications: Soft Matter 3, 551 (2007) J. Phys. Chem. C 111, 8233 (2007) Fluorescence autocorrelation functions showing that streptavidin binds effectively to vesicle-attached biotin even when nanoparticles stabilize the liposomes to which biotin is attached. 500 nm Δπ=300 mM Δπ=400 mM t=0 min t=20 min Δπ=200 mM Δπ=100 mM Epifluorescence images of naked GUVs (left) and nanoparticle-stabilized GUVs (right) reveal enhanced osmotic stress tolerance for the latter. Nanoparticle-stiffened phospholipid vesicles DNA mobility on homogeneous bilayers ( a) & (b) FRAP images of DNA adsorbed on DMTAP bilayers at T = 48 °C and T = 16.3 °C (c) Diffusivity of the adsorbed DNA on a supported bilayer of DMTAP (  ) and DOTAP ( ◊ ) Adsorption of ss-DNA on cationic lipid bilayer composed of DMTAP or DOTAP - + t=0sect=180sect=300sec DNA electrophoresis on lipid bilayers DNA : 5’- [A488]CTCAAATTGGGCAGCCTTCAC(21mer) Bilayer : 99%DOTAP+1%Texas Red Electric field: 30 V/ cm Buffer: 1mM Tris(Hydroxymethyl) Amino methane 10mM NaCl pH 7-8 Diffusivity of the adsorbed DNA (  ) plotted as a function of the lipid (DMTAP) diffusivity. Also shown is the diffusivity of bacteriorhodopsin in liposomes plotted as a function of lipid mobility in the presence of protein at different Lipid(L)/Protein(P) ratios. L/P = 140 (  ) and L/P = 30 (  ) (adapted from Peters et al,PNAS, 79,4317( 1982)) Lipid mobility controls the diffusivity of short biopolymer adsorbates Langmuir,22, 6750(2006) Modulating lipid and DNA diffusivity with temperature Isothermal titration calorimetry shows the affinity of nanoparticles to lipid membrane depends on the surface charge of particles. The binding can be divided into two categories: enthalpy driven, and entropy driven, accordingly. The binding strength is >>kT. Positively charged particles B AC D Negatively charged particles Enthalpy driven Entropy driven A B Dielectric environment sensitive fluorescence demonstrates the ability of nanoparticles to locally induce liquid-gel phase transition in lipid membranes, which is the driving force for particle binding. Negatively charged particles Liquid-gel Positively charged particles Gel->liquid Advance made here: particle binding modulates the membrane structure significantly In progress: particle packing and induced local curvature gel θ - + liquid + - θ - + electrostatic Particle binding induces local phase transition in lipid membranes Future Work: DNA electrophoresis on heterogeneous bilayers containing fluid phase cationic lipids Size-dependent separation of DNA by electrophoresis in the presence of micro domains (obstacles) - + % DSPC Diffusivity of DNA ( μ m 2 /sec) Schematic illustrating proposed electrophoresis on heterogeneous lipid bilayer Controlling DNA adsorption and transport with domain- containing lipid bilayers DNA adsorbed on a bilayer with varying concentrations of DSPC and DOTAP (a)0%DSPC, (b) 10%DSPC, and (c) 40%DSPC a 50μm b 50μm c 50μm Confocal Images of GUVs containing i)5% and ii-iv) 20% cholesterol. Characterization by FRET of peptide clustering due to cholesterol dependent phase separation Characterization by FRET of peptide clustering due to calcium ion-induced phase separation Controlling Biomolecule Recognition Using Raft-Mimetic Lipid Bilayers Actively Induced Phase Separation Angew. Chem. 119, 2257 (2007) Enhanced efficiency of Recognition using raft-mimetic liposomes Phase separation leads to an increase in the efficiency of polyvalent recognition Phase separation provides a general mechanism to increase efficiency of polyvalent recognition Confocal image of actively phase separated GUV Peptide-lipid conjugate Gel-Phase lipids Fluid-Phase lipids Phase separation Induced by calcium No cholesterol 5% cholesterol 20% cholesterol Conclusions Lipid mobility controls the diffusivity of short biopolymer adsorbates. Formation of raft-inspired lipid bilayers enhances the effectiveness of polyvalent recognition. Domain formation in lipid bilayers and biomolecule recognition can be actively controlled. Domains in lipid bilayers provide control over the adsorption and transport of DNA. Nanoparticles stabilize phospholipid vesicles by preventing vesicle fusion even at high vesicle concentrations. Nanoparticles do not interfere with receptor binding or functionalization of bilayer lipids. Nanoparticle binding can locally induce phase transitions in lipid membranes. Education and Outreach The project has already contributed to the training and development of four graduate students (Krishna Athmakuri, Jeffrey Litt, Chakradhar Padala, and Yan Yu), one undergraduate student (Andrew Devine) and a high school student (Kevin Crimmins). Students are introduced to an interdisciplinary research environment and gain expertise in topics ranging from soft materials to nanotechnology, biophysics, transport phenomena, and biomaterials. Further training is provided through outreach efforts, such as presentations to high school students in the New Visions High School Program and to a high school teacher, Ms. Tammy Borland. t=0 min t=20 min Phys. Rev. Lett. 98, (2007)