Systems Biology at the Center for BioSystemsAnalysis ZBSA.

Slides:



Advertisements
Similar presentations
Martin John Bishop UK HGMP Resource Centre Hinxton Cambridge CB10 1 SB
Advertisements

Molecular Biomedical Informatics Machine Learning and Bioinformatics Machine Learning & Bioinformatics 1.
Characterization of Transcriptional Regulatory Networks controlling plant cell adaptation to environmental stresses.
Collaborative Information Management: Advanced Information Processing in Bioinformatics Joost N. Kok LIACS - Leiden Institute of Advanced Computer Science.
August 19, 2002Slide 1 Bioinformatics at Virginia Tech David Bevan (BCHM) Lenwood S. Heath (CS) Ruth Grene (PPWS) Layne Watson (CS) Chris North (CS) Naren.
Bioinformatics For MNW 2 nd Year Jaap Heringa FEW/FALW Integrative Bioinformatics Institute VU (IBIVU) Tel ,
Bioinformatics Master’s Course Genome Analysis ( Integrative Bioinformatics ) Lecture 1: Introduction Centre for Integrative Bioinformatics VU (IBIVU)
Bioinformatics Needs for the post-genomic era Dr. Erik Bongcam-Rudloff The Linnaeus Centre for Bioinformatics.
Structural Genomics – an example of transdisciplinary research at Stanford Goal of structural and functional genomics is to determine and analyze all possible.
Systems Biology Existing and future genome sequencing projects and the follow-on structural and functional analysis of complete genomes will produce an.
By: Alex & Sophie BIOCHEMIST & BIOPHYSICIST. Closely related to medical scientists, biochemists and biophysicists study living organisms at the molecular.
Pathways Bioinformatics & Biomolecular Center at the City College of New York Marshak Science Building, Room 1102 Tel: 212/ Fax: 212/
The Golden Age of Biology DNA -> RNA -> Proteins -> Metabolites Genomics Technologies MECHANISMS OF LIFE Health Care Diagnostics Medicines Animal Products.
Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.
What Do Toxicologists Do?
Genetics: From Genes to Genomes
National Institute on Aging Richard J. Hodes, M.D. Director,NIA/NIH/DHHS ADC Meeting – NIH Roadmap and Budget October 2003.
Promoting Young Researchers in International Cooperation MORE Ankara, 11 October 2005.
Integrative and Comparative Biology 2009 C. Schwenk, D.K. Padilla, G.S. Bakken, R.J. Full.
---- Mark Borodovsky a short intro Position open: Scientist - Pathway Informatics (June 2009) THE POSITION The successful candidate will join the Computational.
The NIH Roadmap for Medical Research
Medical Informatics Basics
Proposal for a European Faculty of Regenerative Medicine ScanBalt Campus Knowledge centers.
EU Framework Programme 6, Priority 5: ”Food Quality and Safety”,Topic 41: “Human health implications of exposure to chemical residues in the environment”
MPIZ, 28 October History of the MPIZ 1927 Foundation in Müncheberg near Berlin 1948 joined the Max Planck Society 1956 transferred to Cologne Since.
Bioinformatics Sean Langford, Larry Hale. What is it?  Bioinformatics is a scientific field involving many disciplines that focuses on the development.
1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.
Shankar Subramaniam University of California at San Diego Data to Biology.
Institute of Systems Biology (INBIOSIS)/ School of Biosciences & Biotechnology (Faculty of Science & Technology), Bioinformatics Development in Malaysia.
Bioinformatics and it’s methods Prepared by: Petro Rogutskyi
Beyond the Human Genome Project Future goals and projects based on findings from the HGP.
GTL Facilities Computing Infrastructure for 21 st Century Systems Biology Ed Uberbacher ORNL & Mike Colvin LLNL.
Modeling Complex Interactions of Overlapping River and Road Networks in a Changing Landscape Programmatic overview Hypothesis Preliminary findings.
Budapest Science Forum (November 8-10 , 2003) Session on Knowledge and Science New Situations in Science : Research Fields, Disciplines, Integration and.
Dr. Siegfried Neumann-hg: WTEC_Demo_ ppt 1 A German Initiative on Systems Biology of Human Hepatocytes Systems of Life - Systems Biology Presentation.
The Cancer Systems Biology Consortium (CSBC)
GTL User Facilities Facility IV: Analysis and Modeling of Cellular Systems Jim K. Fredrickson.
Expanding Biomedical Research in Maine Mount Desert Island Biological Laboratory Patricia H. Hand, Ph.D. Administrative Director.
Bioinformatics For MNW 2 nd Year Jaap Heringa FEW/FALW Centre for Integrative Bioinformatics VU (IBIVU) Tel ,
Modeling of complex systems: what is relevant? Arno Knobbe, Marvin Meeng, Joost Kok Leiden Institute of Advanced Computer Science (LIACS)
ASCAC-BERAC Joint Panel on Accelerating Progress Toward GTL Goals Some concerns that were expressed by ASCAC members.
Bioinformatics Core Facility Guglielmo Roma January 2011.
I-BIO Frontier Fellowship 모집 연구 분야 0 1. 국가과학자 연구주제.
Systems Biology ___ Toward System-level Understanding of Biological Systems Hou-Haifeng.
Overview of NSF and the Directorate for Biological Sciences (BIO) Overview of NSF and the Directorate for Biological Sciences (BIO) Tom Brady Division.
Microarrays.
NY Times Molecular Sciences Institute Started in 1996 by Dr. Syndey Brenner (2002 Nobel Prize winner). Opened in Berkeley in Roger Brent,
OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best.
Decoding the Network Footprint of Diseases With increasing availability of data, there is significant activity directed towards correlating genomic, proteomic,
EB3233 Bioinformatics Introduction to Bioinformatics.
Genome Biology and Biotechnology The next frontier: Systems biology Prof. M. Zabeau Department of Plant Systems Biology Flanders Interuniversity Institute.
Network 1 Ursula Klingmüller Regenerating Hepatocytes - a Systems Biology Approach Coordinator: HD Dr. Jens Timmer Center for Data Analysis and Modeling.
Inflammatory Bowel Diseases November 19, 2007 NCDD Meeting Chair: Daniel K. Podolsky, MD Vice Chair: Eugene B. Chang, MD.
Modeling and Simulation of Signal Transduction Pathways Mark Moeller & Björn Oleson Supervisors: Klaus Prank Ralf Hofestädt.
Dynamical Modeling in Biology: a semiotic perspective Junior Barrera BIOINFO-USP.
High throughput biology data management and data intensive computing drivers George Michaels.
The evaluator point of view…. “IDEAS, ERC Starting Grant 2007” Henriette Molinari Department of Biotechnology University of Verona.
German-Japanese Workshop Computational and Systems Neuroscience, Berlin, May 25-28, The Bernstein Network for Computational Neuroscience.
Center for Bioinformatics and Genomic Systems Engineering Bioinformatics, Computational and Systems Biology Research in Life Science and Agriculture.
1 Modelling and Simulation EMBL – Beyond Molecular Biology Physics Computational Biology Chemistry Medicine.
University of Pavia Dep. of Electrical, Computer and Biomedical Engineering Laboratory of Bioinformatics, Mathematical Modelling and Synthetic Biology.
The University of Colorado BioFrontiers
“Proteomics is a science that focuses on the study of proteins: their roles, their structures, their localization, their interactions, and other factors.”
Biological Information and Biological Databases
Тархи ба оюун \Brain and Mind\
Bioinformatics For MNW 2nd Year
The increasing availability of quantitative biological data from the human genome project, coupled with advances in instrumentation, reagents, methodologies,
Programmatic overview Hypothesis Preliminary findings
Cv The Göttingen Campus A STRONG ALLIANCE.
Presentation transcript:

Systems Biology at the Center for BioSystemsAnalysis ZBSA

„To understand complex biological systems requires the integration of experimental and computational research -- in other words a systems biology approach“ Hiroaki Kitano, Nature 2002 "Systems biology...is about putting together rather than taking apart, integration rather than reduction. It requires that we develop ways of thinking about integration that are as rigorous as our reductionist programmes, but different....It means changing our philosophy, in the full sense of the term“ Denis Nobel, 2006 Systems Biology

NEW KNOWLEDGE EXPERIMENTAL DATA; KNOWLEDGE OF STRUCTURES; FUNCTIONS AND INTERACTIONS MATHEMATICAL MODEL BIOLOGICAL PHENOMENON IN VITRO-/ IN VIVO- EXPERIMENT IN SILICO EXPERIMENT (SIMULATION) NEW DATA HYPOTHESIS

Life Sciences, Engineering, Computer Sciences and Mathematics merge at the ZBSA NATURE|Vol 445|22 February 2007

ZBSA Prof. Jens Timmer Acting Director Prof. Ralf Baumeister Founding Director ( ) Prof. Wolfgang Driever Initiator ( ) Director since 7/2010

Scientists from six faculties work together in multidisziplinary projects at the ZBSA Medicine Mathematic s Physics Biology Chemistry Pharmacology Forestry and Environment Informatics and Microsystems Bernstein Center for Computational Neuroscience

Structure of the ZBSA Structure ZBSA Bioinformatics – Data Management Systems Biology -Modelling Core Facilities – Measurement Technology Metabolomics Life Imaging ProteomicsGenomics Data Acquisition Data Analysis Scientific Focus Metabolic Networks Regulatory Networks: Supracellular Molecular Systems Cellular Systems Project Areas Structure ZBSA Bioinformatics – Data Management Systems Biology -Modelling Core Facilities – Measurement Technology Metabolomics Life Imaging ProteomicsGenomics Data Acquisition Data Analysis Scientific Focus Metabolic Networks Regulatory Networks: Supracellular Molecular Systems Cellular Systems Project Areas Bioinformatics – Data Management Systems Biology -Modelling Core Facilities – Measurement Technology Metabolomics Life Imaging ProteomicsGenomics Data Acquisition Data Analysis Scientific Focus Metabolic Networks Regulatory Networks: Supracellular Molecular Systems Cellular Systems Project Areas

Genetic dispositionDevelopment Environment Proteins, Protein- Networks Genes, Gene Networks Metabolites, metabobic Neworks Systems Biology Metabolomics Genomics Proteomics Life Imaging

ZBSA – an Interdisciplinary Center Technologies Genomics Proteomics Imaging Metabolomics Seminars and MeetingsJunior Groups IT and Theory Data Analysis Modelling Land Baden-Württemberg: Building: 17,5 Mio Euro Equipement: 2,5 Mio Euro

Core Facilities for Quantitative High Quality Data: The Experimental Basis for Modelling and Systems Analysis MetabolomicsGenomicsProteomicsLife Imaging Dr. Kurz Dr. Schlosser Dr. Kammerer Dr. Nitschke

The ZBSA is instrumental for the excellence research centers at the University of Freiburg Research Cluster of Excellence FRIAS LiFENET Freiburg Institute of Advanced Studies Complex systems – systems biology Graduate School

The Freiburg Initiative for Systems Biology - FRISYS  Integration of theoretical and experimental efforts to define intact biological systems  Modelling and systems’ analysis of signalling processes in growth and differentiation  Model organisms at phylogenetic key positions  Dedicated Systems Biology curriculum in order to train highly qualified scientists for this field Coordinator: Wolfgang R. Hess

AKT1 Systembiologie des Alterns InsR PI3K PIP3 PTEN PIP2 PDK1 AKT2 SGK1 FOXO ? MAPKKK MAPKK MAPK SKN-1 SKN1 EGFR RAF GRB-2 RAS stress developmental +neuronal signals stress, insulin nutrients + ? JNK JKK ? SHC-1 cell cycle control apoptosis stress response ageing stress response ageing, telomere maintenance SOS MEK MAPK SIR2 PEPT1 Raptor TOR ? eIF4B S6K ? cellular senescence protein integrity stress control DJ1 PINK1 ? Parkin? Proteomics Jörn Dengjel FRIAS LIFENET Signalling Tilmann Brummer bioss Networks Enrico Schmidt FRISYS/bioss Modelling Hauke Busch FRIAS LIFENET Robotics and Automation Anke Becker FRISYS Promotion of Junior Faculty 14 Junior Faculty at ZBSA

Research – Strategic Areas Systems biology of development and differentiation Signaling and decision mechanisms in cell populations Dynamic control of cell states by transcriptional networks and regulatory RNAs

Research – Future plans Collaborative Research Center CRC of German Research Council DFG Quantitative analysis and modelling of mechanisms in development and differentiation Trinational initiative of Freiburg with –IGBMC Strasbourg –BSSE / ETH at Basel

Legend: EUCOR University Strasbourg SystemsX Basel/Zurich Systems Biology In the D – F – CH Trinational region International Network

Where are all the ZBSA Systems Biologists?

2nd Annual ZBSA Retreat Feldberg-Altglasshütten November

Thank you for your attention! Wolfgang Driever

Systems Biology "Systems Biology aims at an improved understanding of biology and its mechanisms, in particular of the functions and interactions of key elements of living systems (DNA, RNA, proteins, cells). Systems biology is the sum of novel methodological approaches to (a) gather and analyse this knowledge, (b) to translate this knowledge into a thorough understanding that eventually will allow predicting the behavior of the complex and dynamic networks that regulate living specimen. The focus of systems biology is clearly not limited to the description of existing knowledge using a different syntax, but aims at combining available methods synergistically to develop novel approaches for the characterization of the behavior of biological networks. Whereas traditional research in the Life Sciences generally emphasizes the operational necessity of a gene, protein, component for the correct execution of a particular pathway or regulatory mechanism (what is it doing, is it necessary or sufficient?), it is the Systems Biology that expands these questions in an attempt to define the relevance of a particular component or mechanism for fulfilling a biological goal (Why is it performing the way it is to accomplish this or that task? How does the component need to be designed in order to fulfill its function)." Prof. Ralf Baumeister Director ZBSA