Building Scalable Scientific Applications with Makeflow Douglas Thain and Dinesh Rajan University of Notre Dame Applied Cyber Infrastructure Concepts University.

Slides:



Advertisements
Similar presentations
1 Real-World Barriers to Scaling Up Scientific Applications Douglas Thain University of Notre Dame Trends in HPDC Workshop Vrije University, March 2012.
Advertisements

Lobster: Personalized Opportunistic Computing for CMS at Large Scale Douglas Thain (on behalf of the Lobster team) University of Notre Dame CVMFS Workshop,
EHarmony in Cloud Subtitle Brian Ko. eHarmony Online subscription-based matchmaking service Available in United States, Canada, Australia and United Kingdom.
Experience with Adopting Clouds at Notre Dame Douglas Thain University of Notre Dame IEEE CloudCom, November 2010.
Introduction to Scalable Programming using Makeflow and Work Queue Dinesh Rajan and Mike Albrecht University of Notre Dame October 24 and November 7, 2012.
1 Condor Compatible Tools for Data Intensive Computing Douglas Thain University of Notre Dame Condor Week 2011.
1 High Throughput Scientific Computing with Condor: Computer Science Challenges in Large Scale Parallelism Douglas Thain University of Notre Dame UAB 27.
1 Opportunities and Dangers in Large Scale Data Intensive Computing Douglas Thain University of Notre Dame Large Scale Data Mining Workshop at SIGKDD August.
1 Scaling Up Data Intensive Science with Application Frameworks Douglas Thain University of Notre Dame Michigan State University September 2011.
1 Models and Frameworks for Data Intensive Cloud Computing Douglas Thain University of Notre Dame IDGA Cloud Computing 8 February 2011.
1 Scaling Up Data Intensive Science to Campus Grids Douglas Thain Clemson University 25 Septmber 2009.
Getting Started with Linux Douglas Thain University of Wisconsin, Computer Sciences Condor Project October 2000.
Getting Beyond the Filesystem: New Models for Data Intensive Scientific Computing Douglas Thain University of Notre Dame HEC FSIO Workshop 6 August 2009.
Cooperative Computing for Data Intensive Science Douglas Thain University of Notre Dame NSF Bridges to Engineering 2020 Conference 12 March 2008.
Introduction to Makeflow Li Yu University of Notre Dame 1.
Undergraduate Poster Presentation Match 31, 2015 Department of CSE, BUET, Dhaka, Bangladesh Wireless Sensor Network Integretion With Cloud Computing H.M.A.
Building Scalable Elastic Applications using Makeflow Dinesh Rajan and Douglas Thain University of Notre Dame Tutorial at CCGrid, May Delft, Netherlands.
Building Scalable Scientific Applications using Makeflow Dinesh Rajan and Peter Sempolinski University of Notre Dame.
HPCC Mid-Morning Break Interactive High Performance Computing Dirk Colbry, Ph.D. Research Specialist Institute for Cyber Enabled Discovery.
Building Scalable Applications on the Cloud with Makeflow and Work Queue Douglas Thain and Patrick Donnelly University of Notre Dame Science Cloud Summer.
Introduction to Makeflow and Work Queue CSE – Cloud Computing – Fall 2014 Prof. Douglas Thain.
Portable Resource Management for Data Intensive Workflows Douglas Thain University of Notre Dame.
Apache Airavata GSOC Knowledge and Expertise Computational Resources Scientific Instruments Algorithms and Models Archived Data and Metadata Advanced.
Design of an Active Storage Cluster File System for DAG Workflows Patrick Donnelly and Douglas Thain University of Notre Dame 2013 November 18 th DISCS-2013.
Elastic Applications in the Cloud Dinesh Rajan University of Notre Dame CCL Workshop, June 2012.
Software Architecture
CS525: Special Topics in DBs Large-Scale Data Management Hadoop/MapReduce Computing Paradigm Spring 2013 WPI, Mohamed Eltabakh 1.
Toward a Common Model for Highly Concurrent Applications Douglas Thain University of Notre Dame MTAGS Workshop 17 November 2013.
Hadoop/MapReduce Computing Paradigm 1 Shirish Agale.
Introduction to Work Queue Applications CSE – Cloud Computing – Fall 2014 Prof. Douglas Thain.
Large Scale Sky Computing Applications with Nimbus Pierre Riteau Université de Rennes 1, IRISA INRIA Rennes – Bretagne Atlantique Rennes, France
Building Scalable Scientific Applications using Makeflow Dinesh Rajan and Douglas Thain University of Notre Dame.
The Cooperative Computing Lab  We collaborate with people who have large scale computing problems in science, engineering, and other fields.  We operate.
Introduction to Scalable Programming using Work Queue Dinesh Rajan and Ben Tovar University of Notre Dame October 10, 2013.
1 Computational Abstractions: Strategies for Scaling Up Applications Douglas Thain University of Notre Dame Institute for Computational Economics University.
Introduction to Work Queue Applications Applied Cyberinfrastructure Concepts Course University of Arizona 2 October 2014 Douglas Thain and Nicholas Hazekamp.
Tool Integration with Data and Computation Grid GWE - “Grid Wizard Enterprise”
Grid Computing at Yahoo! Sameer Paranjpye Mahadev Konar Yahoo!
 Apache Airavata Architecture Overview Shameera Rathnayaka Graduate Assistant Science Gateways Group Indiana University 07/27/2015.
Building Scalable Scientific Applications with Work Queue Douglas Thain and Dinesh Rajan University of Notre Dame Applied Cyber Infrastructure Concepts.
July 11-15, 2005Lecture3: Grid Job Management1 Grid Compute Resources and Job Management.
Review of Condor,SGE,LSF,PBS
Introduction to Makeflow and Work Queue Prof. Douglas Thain, University of Notre Dame
U N I V E R S I T Y O F S O U T H F L O R I D A Hadoop Alternative The Hadoop Alternative Larry Moore 1, Zach Fadika 2, Dr. Madhusudhan Govindaraju 2 1.
Analyzing LHC Data on 10K Cores with Lobster and Work Queue Douglas Thain (on behalf of the Lobster Team)
Introduction to Scalable Programming using Work Queue Dinesh Rajan and Mike Albrecht University of Notre Dame October 24 and November 7, 2012.
Tool Integration with Data and Computation Grid “Grid Wizard 2”
Hadoop/MapReduce Computing Paradigm 1 CS525: Special Topics in DBs Large-Scale Data Management Presented By Kelly Technologies
Grid Compute Resources and Job Management. 2 Grid middleware - “glues” all pieces together Offers services that couple users with remote resources through.
3/12/2013Computer Engg, IIT(BHU)1 PARALLEL COMPUTERS- 1.
{ Tanya Chaturvedi MBA(ISM) Hadoop is a software framework for distributed processing of large datasets across large clusters of computers.
Building Scalable Elastic Applications using Work Queue Dinesh Rajan and Douglas Thain University of Notre Dame Tutorial at CCGrid, May Delft,
Demonstration of Scalable Scientific Applications Peter Sempolinski and Dinesh Rajan University of Notre Dame.
Building Scalable Scientific Applications with Work Queue Douglas Thain and Dinesh Rajan University of Notre Dame Applied Cyber Infrastructure Concepts.
HTCondor’s Grid Universe Jaime Frey Center for High Throughput Computing Department of Computer Sciences University of Wisconsin-Madison.
Tutorial on Science Gateways, Roma, Catania Science Gateway Framework Motivations, architecture, features Riccardo Rotondo.
Introduction to Makeflow and Work Queue Nicholas Hazekamp and Ben Tovar University of Notre Dame XSEDE 15.
The EPIKH Project (Exchange Programme to advance e-Infrastructure Know-How) gLite Grid Introduction Salma Saber Electronic.
Accessing the VI-SEEM infrastructure
Introduction to Makeflow and Work Queue
Introduction to Distributed Platforms
Scaling Up Scientific Workflows with Makeflow
Introduction to Makeflow and Work Queue
Introduction to Makeflow and Work Queue
Haiyan Meng and Douglas Thain
Introduction to Makeflow and Work Queue
Introduction to Makeflow and Work Queue
Introduction to Makeflow and Work Queue with Containers
What’s New in Work Queue
Creating Custom Work Queue Applications
Presentation transcript:

Building Scalable Scientific Applications with Makeflow Douglas Thain and Dinesh Rajan University of Notre Dame Applied Cyber Infrastructure Concepts University of Arizona, September 11, 2012

The Cooperative Computing Lab

The Cooperative Computing Lab We collaborate with people who have large scale computing problems in science, engineering, and other fields. We operate computer systems on the O(10,000) cores: clusters, clouds, grids. We conduct computer science research in the context of real people and problems. We develop open source software for large scale distributed computing. 3

Science Depends on Computing! AGTCCGTACGATGCTATTAGCGAGCGTGA…

The Good News: Computing is Plentiful! 5

Big clusters are cheap! 7

8 I have a standard, debugged, trusted application that runs on my laptop. A toy problem completes in one hour. A real problem will take a month (I think.) Can I get a single result faster? Can I get more results in the same time? Last year, I heard about this grid thing. What do I do next? This year, I heard about this cloud thing.

What they want. 9 What they get.

I can get as many machines on the cloud as I want! How do I organize my application to run on those machines?

Our Philosophy: Harness all the resources that are available: desktops, clusters, clouds, and grids. Make it easy to scale up from one desktop to national scale infrastructure. Provide familiar interfaces that make it easy to connect existing apps together. Allow portability across operating systems, storage systems, middleware… Make simple things easy, and complex things possible. No special privileges required.

A Quick Tour of the CCTools Open source, GNU General Public License. Compiles in 1-2 minutes, installs in $HOME. Runs on Linux, Solaris, MacOS, Cygwin, FreeBSD, … Interoperates with many distributed computing systems. – Condor, SGE, Torque, Globus, iRODS, Hadoop… Components: – Makeflow – A portable workflow manager. – Work Queue – A lightweight distributed execution system. – All-Pairs / Wavefront / SAND – Specialized execution engines. – Parrot – A personal user-level virtual file system. – Chirp – A user-level distributed filesystem.

Makeflow: A Portable Workflow System

15 An Old Idea: Makefiles part1 part2 part3: input.data split.py./split.py input.data out1: part1 mysim.exe./mysim.exe part1 >out1 out2: part2 mysim.exe./mysim.exe part2 >out2 out3: part3 mysim.exe./mysim.exe part3 >out3 result: out1 out2 out3 join.py./join.py out1 out2 out3 > result

16 Makeflow = Make + Workflow Makeflow LocalCondorTorque Work Queue Provides portability across batch systems. Enable parallelism (but not too much!) Fault tolerance at multiple scales. Data and resource management.

Makeflow Syntax [output files] : [input files] [command to run] sim.exe in.dat calib.dat out.txt sim.exe in.dat –p 50 > out.txt out.txt : in.dat sim.exe –p 50 in.data > out.txt One Rule Not Quite Right! out.txt : in.dat calib.dat sim.exe sim.exe –p 50 in.data > out.txt

You must state all the files needed by the command.

sims.mf out.10 : in.dat calib.dat sim.exe sim.exe –p 10 in.data > out.10 out.20 : in.dat calib.dat sim.exe sim.exe –p 20 in.data > out.20 out.30 : in.dat calib.dat sim.exe sim.exe –p 30 in.data > out.30

How to run a Makeflow Run a workflow locally (multicore?) – makeflow -T local sims.mf Clean up the workflow outputs: – makeflow –c sims.mf Run the workflow on Torque: – makeflow –T torque sims.mf Run the workflow on Condor: – makeflow –T condor sims.mf

Example: Biocompute Portal Generate Makefile Make flow Run Workflow Progress Bar Transaction Log Update Status Condor Pool Submit Tasks BLAST SSAHA SHRIMP EST MAKER …

Makeflow + Work Queue

Private Cluster Campus Condor Pool Public Cloud Provider FutureGrid Torque Cluster Makefile Makeflow Local Files and Programs Makeflow + Batch System makeflow –T torque makeflow –T condor ???

FutureGrid Torque Cluster Campus Condor Pool Public Cloud Provider Private Cluster Makefile Makeflow Local Files and Programs Makeflow + Work Queue W W W ssh WW W W torque_submit_workers W W W condor_submit_workers W W W Thousands of Workers in a Personal Cloud submit tasks

Advantages of Work Queue Harness multiple resources simultaneously. Hold on to cluster nodes to execute multiple tasks rapidly. (ms/task instead of min/task) Scale resources up and down as needed. Better management of data, with local caching for data intensive tasks. Matching of tasks to nodes with data.

Makeflow and Work Queue To start the Makeflow % makeflow –T wq sims.mf Could not create work_queue on port % makeflow –T wq –p 0 sims.mf Listening for workers on port 8374… To start one worker: % work_queue_worker alamo.futuregrid.org 8374

Start Workers Everywhere! Submit workers to Torque: torque_submit_workers alamo.futuregrid.org Submit workers to Condor: condor_submit_workers alamo.futuregrid.org Submit workers to SGE: sge_submit_workers alamo.futuregrid.org

Keeping track of port numbers gets old fast…

Project Names Worker work_queue_worker -a –N myproject Catalog connect to alamo:4057 advertise “myproject” is at alamo:4057 query Makeflow (port 4057) makeflow … –a –N myproject query work_queue_status

Project Names Start Makeflow with a project name: % makeflow –T wq –p 0 –a –N arizona-class sims.mf Listening for workers on port XYZ… Start one worker: % work_queue_worker -a -N arizona-class Start many workers: % torque_submit_workers –a –N arizona-class 5

work_queue_status

Resilience and Fault Tolerance MF +WQ is fault tolerant in many different ways: – If Makeflow crashes (or is killed) at any point, it will recover by reading the transaction log and continue where it left off. – Makeflow keeps statistics on both network and task performance, so that excessively bad workers are avoided. – If a worker crashes, the master will detect the failure and restart the task elsewhere. – Workers can be added and removed at any time during the execution of the workflow. – Multiple masters with the same project name can be added and removed while the workers remain. – If the worker sits idle for too long (default 15m) it will exit, so as not to hold resources idle.

Other parts of the CCTools…

34 Parrot Virtual File System LocalHTTPCVMFSChirpiRODS Ordinary Appl Filesystem Interface: open/read/write/close Web Servers iRODS Server CVMFS Network Chirp Server Parrot Virtual File System

Example of Using Parrot % parrot_run bash [short pause] % cat /http/ % ls –la /anonftp/ftp.gnu.org % cd /irods/data.iplantcollaborative.org % cd iplant/home % ls –la collections nirav nirav_test1 rogerab shared

All-Pairs and Wavefront B1 B2 B3 A1A2A3 FFF F FF FF F M[4,2] M[3,2]M[4,3] M[4,4]M[3,4]M[2,4] M[4,0]M[3,0]M[2,0]M[1,0]M[0,0] M[0,1] M[0,2] M[0,3] M[0,4] F x yd F x yd F x yd F x yd F x yd F x yd F F y y x x d d x FF x ydyd allpairs A.list B.list F.exe wavefront M.data F.exe Specialized tools for very specific workflow patterns.

Example of Using All-Pairs % compare.exe A1 B1 similarity 25.3% at position 65 % allpairs_master A.list B.list compare.exe A1B1similarity 25.3% at position 65 A2B1similarity 85.6% at position 10 A3B1similarity 98.4% at position 48 A1B2similarity 31.3% at position 91 …

Private Cluster Campus Condor Pool Public Cloud Provider Shared SGE Cluster Elastic Application Stack W W W W W W W W WvWv Work Queue Library All-PairsWavefrontMakeflow Custom Apps Thousands of Workers in a Personal Cloud

Next Steps: Tutorial: Basic examples of how to use Makeflow on Future Grid. Homework: Problems to work on this week.

Go to: Click “Lecture and Tutorial for Applied CI Concepts Class”