Copyright OpenHelix. No use or reproduction without express written consent1
Primer3 Select Primers from DNA Sequence Materials prepared by: Mary E. Mangan, Ph.D. Updated: Q Primer3 software was developed by the Whitehead Institute for Biomedical Research, but use of the name Whitehead Institute does not imply endorsement or promotion of this tutorial by the Whitehead Institute. Primer3 Copyright (c) 1996,1997,1998,1999,2000,2001,2004,2006,2007 Whitehead Institute for Biomedical Research. All rights reserved. Version 4
Copyright OpenHelix. No use or reproduction without express written consent3 Primer3 Agenda Introduction and Credits Basic Primer Selection Advanced Primer Selection Primer3 Source Code Summary Exercises Primer3:
Copyright OpenHelix. No use or reproduction without express written consent4 Primer3 Background Methods in Molecular Biology vol. 132 Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp
Copyright OpenHelix. No use or reproduction without express written consent5 Primer3, Based on Primer 0.5 Primer3’s ancestor was Primer 0.5 Still can be found at:
Copyright OpenHelix. No use or reproduction without express written consent6 Primer3, What is It? Simple Form Primer3 is freely available, web interface (shown here) or downloadable source code Say which primers you want Results show starting sequence, left, internal, or right primers, and additional facts about the chosen primers Paste your DNA sequence Primer3 selects oligonucleotide primers from a DNA sequence
Copyright OpenHelix. No use or reproduction without express written consent7 Primer3 Advanced Features Overview of entire page here Different sections permit advanced design options simple form specify included or excluded regions general conditions (size, Tm, GC) sequence quality set penalties tweak internal primer features copyright, disclaimer acknowledgments
Copyright OpenHelix. No use or reproduction without express written consent8 Primer3, Where is It? Primer3 at The Whitehead Institute at MIT at: Primer3 is a very popular tool so is installed locally at other sites. (Try a Google search to find other copies of Primer3.)
Copyright OpenHelix. No use or reproduction without express written consent9 Primer3 Agenda Introduction and Credits Basic Primer Selection Advanced Primer Selection Primer3 Source Code Summary Exercises Primer3:
Copyright OpenHelix. No use or reproduction without express written consent10 Primer3: Basic Primer Selection Paste DNA sequence here Primer pairs, or just single primers Internal hybridization probes Click “Pick Primers” to run Primer3
Copyright OpenHelix. No use or reproduction without express written consent11 Primer3 Conventions Primers (or oligos) referred to as left and right ATGCATCGGATATCCTGATCATTAGAATATGCATCATCGGATAATGC TACGTAGCCTATAGGACTAGTAATCTTATACGTAGTAGCCTATTACG 5′end upper strand 3′end upper 5′end opposite strand3′end opposite You can also pick internal ones (not shown here) LEFT RIGHT
Copyright OpenHelix. No use or reproduction without express written consent12 Primer3 Conventions II My sample sequence: Caspase-1 inhibitor Iceberg (AY358231) Your query sequence: A,T,G,C or N, and assumed to be 5′ 3′ (other characters/numbers ignored) Can be plain text, or FASTA format
Copyright OpenHelix. No use or reproduction without express written consent13 Primer3 Basic Primer Selection Paste in your DNA sequence Decide which primers you want: check boxes to indicate You can specify one and ask for the other. Type the one you want to use in the box paste seq check boxes or enter text
Copyright OpenHelix. No use or reproduction without express written consent14 Primer3 Masking Repeats Use Ns to hide unwanted sequences, or Choose a repeat library to use as a mask for some known repetitive sequences Click “Pick Primers” to run Primer3
Copyright OpenHelix. No use or reproduction without express written consent15 Primer3 Results, Output Overview Iceberg sequence All default settings Summary info
Copyright OpenHelix. No use or reproduction without express written consent16 Primer3 Results, Location Primer location diagram left primer right primer
Copyright OpenHelix. No use or reproduction without express written consent17 Primer3 Results, Other Selections Other reasonable primers
Copyright OpenHelix. No use or reproduction without express written consent18 Primer3 Results, Statistics Statistics about the query operations
Copyright OpenHelix. No use or reproduction without express written consent19 Primer3 Agenda Introduction and Credits Basic Primer Selection Advanced Primer Selection Primer3 Source Code Summary Exercises Primer3:
Copyright OpenHelix. No use or reproduction without express written consent20 Primer3 Advanced searches Advanced primer selection, by altering the parameters Different options discussed in the upcoming slides simple form specify included or excluded regions general conditions (size, Tm, GC) sequence quality set penalties tweak internal primer features
Copyright OpenHelix. No use or reproduction without express written consent21 Advanced Primer Selection, Regions and Size Select a specific target area Exclude some regions Set the length, or accept default product range sizes Links offer explanations and documentation if no FASTA header Name your sequence (if not using a FASTA file)
Copyright OpenHelix. No use or reproduction without express written consent22 Advanced Primer Selection, General Conditions Set primer melting temperature Tm (mix, max, optimal) Set product melting temperature (if desired) Specify GC content, as a percentage Other options…. You can set primer size (min, max, and optimal)
Copyright OpenHelix. No use or reproduction without express written consent23 Advanced Primer Selection, Other Sequence Features Specify regions to include, with start and length indication Specify a start codon (check documentation on this one) Sequence quality information can be considered
Copyright OpenHelix. No use or reproduction without express written consent24 Advanced Primer Selection, Penalties Set penalties for primers or for pairs Less than Greater than Penalty for being Lt (less than) or Gt (greater than) the optimum (if it could go up or down) Penalty for other options (known to go only one way)
Copyright OpenHelix. No use or reproduction without express written consent25 Advanced Primer Selection, Internal Oligos You can specify parameters for internal oligos as well
Copyright OpenHelix. No use or reproduction without express written consent26 Primer3, Advanced Searches Advanced primer selection, by altering the parameters Different options to precisely tune your primer selection Find more details in documentation simple form specify included or excluded regions general conditions (size, Tm, GC) sequence quality set penalties tweak internal primer features
Copyright OpenHelix. No use or reproduction without express written consent27 Primer3 Agenda Introduction and Credits Basic Primer Selection Advanced Primer Selection Primer3 Source Code Summary Exercises Primer3:
Copyright OpenHelix. No use or reproduction without express written consent28 Primer3 Source Code is Available Install Primer3 locally Can use it as part of a pipeline with other scripts or programs readme paper
Copyright OpenHelix. No use or reproduction without express written consent29 Primer3 Agenda Introduction and Credits Basic Primer Selection Advanced Primer Selection Primer3 Source Code Summary Exercises Primer3:
Copyright OpenHelix. No use or reproduction without express written consent30 Basic Primer Selection Primer3: Select Primers from DNA Sequence Source Code Availability Output left primer right primer Advanced Primer Selection
Copyright OpenHelix. No use or reproduction without express written consent31 Primer3 Agenda Introduction and Credits Basic Primer Selection Advanced Primer Selection Primer3 Source Code Summary Exercises Primer3:
Copyright OpenHelix. No use or reproduction without express written consent32