CHMI 4226E – W20051 Recombinant DNA Technology CHMI 4226 E Week 3 19 January 2009 Toolbox part 3 PCR

CHMI 4226E – W20052 PCR Very powerful method Allows for the in-vitro synthesis of a specific DNA molecule from very limited amounts. 3 basic steps (1 PCR cycle): –DNA denaturation –Primer annealing –Extension with DNA polymerase

CHMI 4226E – W20053 PCR The increase in the amounts of the DNA on interest is exponential: doubles after each cycle (in theory) Fold increase can be determined as follows: –Increase = 2 n n = number of cycles –So, 25 PCR cycles will give you a theoretical amplification of 34 million fold!!! In reality, a two-fold increase per cycle is rarely, if ever, obtained, due to: –Presence of inhibitors –GC-rich regions in the template.

CHMI 4226E – W20054 PCR

CHMI 4226E – W20055 PCR - Reagents

CHMI 4226E – W20056 PCR-Selecting primers

CHMI 4226E – W20057 PCR

CHMI 4226E – W20058 PCR

CHMI 4226E – W20059 PCR 5’ primer: 5’atg gac ggg tcc ggg gag cag ccc 3 ’ – Coding strand 5’atggacgggtccggggagcagcccagaggcggggggccca3’ 3’tacctgcccaggcccctcgtcgggtctccgccccccgggt5’ 5’atggacgggtccggggagcagcccagaggcggggggccca3’ 5’atggacgggtccggggagcagccc 3’ 3’tacctgcccaggcccctcgtcgggtctccgccccccgggt5 ’ 95 o C, 1 min

CHMI 4226E – W PCR

CHMI 4226E – W ’ctcaccgcctcgctcaccatctggaagaagatgggctga3’ 3’gagtggcggagcgagtggtagaccttcttctacccgact5’ 3’tggtagaccttcttctacccgact5’ 5’ctcaccgcctcgctcaccatctggaagaagatgggctga3’ 95 o C, 1 min 3’ Primer: 5’acc atc tgg aag aag atg ggc tga3’ Coding strand 3’tgg tag acc ttc ttc tac ccg act5’ Template strand 5’ tca gcc cat ctt ctt cca gat ggt 3’

CHMI 4226E – W PCR

CHMI 4226E – W PCR Desired properties of PCR primers: –Length: nt; –Melting point (Tm) = o C Tm= 2(A+T) +4(G+C) T anneal = Tm-4 o C –%GC: 35%-65%; –3’ end is rich in GC (acts as a clamp); –No sequence complementary between or within the two primers; –No significant pairing (even incomplete) to other DNA molecules unrelated to the DNA of interest (perform Blast on primers). More on primer design guidelines: – /tech_notes/PCR_Primer_Desi gn.html Software and algorithms: – design.html – /bi/Programs/fastpcr.htm – bin/primer3/primer3_www.cgi

CHMI 4226E – W PCR-Annealing temperature 55 o C50 o C Primer sets M 603 bp 310 bp 281 bp 234 bp 194 bp 118 bp

CHMI 4226E – W PCR – Fidelity of target amplification

CHMI 4226E – W PCR-primers

CHMI 4226E – W PCR-number of cycles While the yield of amplified product increases with the number of cycles, so is the possibility of: –Amplification of partially related sequences; –Introduction of mutations in the amplified DNA.

CHMI 4226E – W PCR-number of cycles

CHMI 4226E – W PCR-Effect of Mg +2 Mg 2+ is a co-factor for all DNA polymerases However, don’t forget that: –Primers and dNTPs bind Mg 2+ –Too much Mg 2+ will favor non-specific DNA hybridization So: an optimal DNA concentration must be found for each pair of primers.

CHMI 4226E – W PCR-Effect of Mg +2 Stoffel fragment: less heat sensitive and no 5’-3’ exonuclease activity.

CHMI 4226E – W PCR-Effect of Mg +2

CHMI 4226E – W PCR-Effect of Mg +2

CHMI 4226E – W PCR- DNA polymerases

CHMI 4226E – W PCR- DNA polymerases Processivity: number of nucleotides polymerized before the DNA pol leaves the DNA molecule. Fidelity: accuracy of the enzyme.

CHMI 4226E – W PCR- DNA polymerases

CHMI 4226E – W PCR- DNA polymerases

CHMI 4226E – W PCR- DNA polymerases IMPORTANT: Fidelity and yield are mutually exclusive!

CHMI 4226E – W PCR-Plateau effect

CHMI 4226E – W PCR-Plateau effect

CHMI 4226E – W PCR-Plateau effect Plateau Effect - The plateau effect is an attenuation of the normally exponential rate of product accumulation in a PCR reaction. It can be caused by: –depletion of dNTPs –depletion of primers –stability of the reactants (e.g. enzyme activity; particularly at the denaturation temperature) –end product inhibition by duplex DNA –non-specific competition for resources (production of incorrect product) –reannealing of specific products to one another instead of to the primers (this is particularly problematic when product concentration is high).

CHMI 4226E – W Major PCR problem: specificity

CHMI 4226E – W Increasing PCR specificity Hot start method

CHMI 4226E – W PCR-Specificity

CHMI 4226E – W Increasing PCR specificity Use of nested primers Using two sets of primers to amplify a DNA fragment: –A first set of primers is used to amplify a longer piece of the DNA of interest; –A second set of primers is used to amplify a smaller section from the amplified region.

CHMI 4226E – W Increasing PCR specificity Touchdown PCR In touchdown PCR, the reaction is first set with an annealing temperature a few degrees (e.g. 5 o C) above the optimal temperature for the primers; During the first few cycles, the annealing temperature is slowly decreased (1 o C per cycle); The aim is to favor the amplification of the DNA of interest over possible competing DNA molecules during the first few cycles of PCR, limiting the amplification of non-specific products in subsequent cycles.

CHMI 4226E – W PCR-GC-rich templates Betaine + -

CHMI 4226E – W PCR vs DNA cloning

CHMI 4226E – W200538

CHMI 4226E – W200539

CHMI 4226E – W200540

CHMI 4226E – W Assignment #4!