Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis

Slides:



Advertisements
Similar presentations
RNA and Protein Synthesis
Advertisements

CH 11.4 & 11.5 “DNA to Polypeptide”.
RNA and Protein Synthesis
RNA and Protein Synthesis
RNA and Protein Synthesis
RNA and Protein Synthesis
10-2: RNA and 10-3: Protein Synthesis
RNA Transcription.
What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.
8.4 DNA Transcription 8.5 Translation
Protein Synthesis Chapter 11.
RNA 13.1 p
Lesson Overview 13.1 RNA.
Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis
Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.
Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.
RNA and Protein Synthesis
VII RNA and Protein Synthesis
Chapter 13: RNA and Protein Synthesis
By: Anne Russell, Madelyn Stroder, Hannah Black, And Bailey Mills.
RNA and Protein Synthesis
RNA and Protein Synthesis
12-3 RNA and Protein Synthesis
 DNA is the blueprint for life – it contains your genetic information  The order of the bases in a segment of DNA (GENE) codes for a particular protein;
Peptide Bond Formation Walk the Dogma RECALL: The 4 types of organic molecules… CARBOHYDRATES LIPIDS PROTEINS (amino acid chains) NUCLEIC ACIDS (DNA.
12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.
Do Now: Define genotype and phenotype. Then determine the relationship between the two.
Transcription and Translation How genes are expressed (a.k.a. How proteins are made) Biology.
PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.
Protein Synthesis. The DNA Code The order of bases along the DNA strand codes for the order in which amino acids are chemically joined together to form.
Transcription, Translation & Protein Synthesis Do you remember what proteins are made of ?  Hundreds of Amino Acids link  together to make one Protein.
Protein Synthesis Traits are determined by proteins (often enzymes) *Protein – 1 or more polypeptide chains *Polypeptide – chain of amino acids linked.
RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.
Question of the DAY Jan 14 During DNA Replication, a template strand is also known as a During DNA Replication, a template strand is also known as a A.
Placed on the same page as your notes Warm-up pg. 48 Complete the complementary strand of DNA A T G A C G A C T Diagram 1 A T G A C G A C T T A A C T G.
RNA and Protein Synthesis Chapter 11 C10L10C12. What are Genes? Genes are coded DNA instructions that control the production of proteins within the cell.
RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.
Chapter 13 – RNA & Protein Synthesis MS. LUACES HONORS BIOLOGY.
Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.
CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…
12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.
Chapter 12.3 DNA, RNA and Protein DNA, RNA, and Protein Molecular Genetics Central Dogma  RNA - Contains the sugar ribose and the base uracil,
Chapter 13 From DNA to Proteins
Notes: Transcription DNA vs. RNA
RNA and Protein Synthesis
Chapter 13.1: RNA Essential Questions
CH 12.3 RNA & Protein Synthesis.
PROTEIN SYNTHESIS CHAPTER 10 section 4
RNA & Protein synthesis
12-3 RNA & Protein Synthesis
Protein Synthesis Standards:
Protein Synthesis.
Protein Synthesis in Detail
RNA Ribonucleic Acid.
12-3 RNA and Protein Synthesis
RNA and Protein Synthesis
Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.
RNA & Protein synthesis
13.1: RNA & Transcription.
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Transcription/ Translation Notes 16-17
12-3 RNA and Protein Synthesis
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Copyright Pearson Prentice Hall
Protein Synthesis.
Protein Synthesis.
Presentation transcript:

Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis Remember ribosomes??? Our goal is to learn how proteins are made. Keep in mind – amino acids are the building blocks of proteins. A chain of amino acids are “polypeptides” .

Role of RNA Ribonucleic acid (RNA) like DNA, but the bases direct protein production. Proteins result in phenotypic traits. Differences b/t DNA & RNA RNA sugar ribose not deoxyribose RNA single strand not 2. RNA has uracil not thymine

RNA molecules make proteins 3 types of RNA 1. Messenger RNA(mRNA)- carries instructions for polypeptide from nucleus to ribosomes in cytoplasm. mRNA

RNA molecules make proteins - 3 types of RNA continued…. 2. Ribosomal RNA (rRNA) – cell structures where proteins are assembled 3. Transfer RNA (tRNA) – carries amino acids to ribosome and matches them to the mRNA message. tRNA mRNA rRNA

RNA Synthesis Making RNA happens in “Transcription” Segments of DNA are templates to produce RNA. The bases complement each other. Eukaryotes – happens in nucleus and moves to cytoplasm to produce protein.

Steps to Make RNA 1. The enzyme RNA polymerase binds to DNA during transcription and separates DNA. 1 strand is the template. 2. RNA polymerase binds to promoter regions of DNA. (START) RNA is edited. Introns cut out, Exons are left and spliced back together to form mRNA.

The Genetic Code DNA has directions for making polypeptides (aka chain of amino acids). The order and type of amino acids in the polypeptide determine the protein. 4 bases – A,C,G,U for uracil Code is read 3 letters at a time the word is a codon.

mRNA bases Amino acids Codons (3 letters read in to out) AUG = Methionine

Translation Ribosomes use the codons in mRNA to assemble amino acids to a polypeptide chain or protein. Process of decoding mRNA to protein is “Translation”. mRNA transcribed (transcription) in nucleus goes to cytoplasm. On ribosome, translation begins at START codon. Each codon attracts an anticodon aka tRNA tRNA carries an amino acid. Amino acids bond and move along the mRNA Continues until reaches STOP codon and forms polypeptide and mRNA is released.

Translation &tRNA - anticodons

Molecular Basis of Heredity Molecular biology tries to explain living organisms using molecules like DNA/RNA Central dogma of molecular biology is info is transferred from DNA to RNA to proteins. Instructions for making proteins are in the genes. Gene expression is the way in which DNA, RNA, proteins are involved in putting genetic info into action in living cells. The genetic code is generally the same in all organisms.