Human Identity Testing Purpose: Match a person to a DNA sample. Examples: Paternity Test Genetic History Historical (Thomas Jefferson, Sally Hemings) Genealogical.

Slides:

Advertisements

Similar presentations

Forensic Bioinformatic Services, Inc.

Advertisements

Brief History of Forensic DNA Typing

Forensic DNA Analysis (Part II)

Forensic DNA Typing or Did you kill (rape…) that person? How DNA can “definitively” say. Adapted from: National Institutes of Science & Technology

Blackett Family DNA Paternity Study

Three generations of DNA testing

DNA Fingerprinting and Forensic Analysis

Fingerprints have been used since 1901 Fingerprints? DNA Fingerprints ! DNA Fingerprints since 1986.

Chapter 1. Speed of Analysis (Technology) Power of Discrimination (Genetics) Low High SlowFast Markers Used (Biology) RFLP Single Locus Probes RFLP Multi-Locus.

Brief History of Forensic DNA Typing

Fingerprints: Nuclear DNA standard. =FBI CODIS (Combined DNA Index System) standard for nuclear DNA utilizes 13 highly-variable tetramer STR sites. CSF1PO.

The Basics of CODIS Combined DNA Index System

DNA Polymorphisms and Human Identification 1 Molecular Diagnostics.

Genetic Statistic Application in Forensic Science Arthur J. Eisenberg, PhD Professor and Chairman Department of Forensic and Investigative Genetics Co-Director.

Forensic DNA Analysis Jelena A. Myers Senior Criminalist (DNA)

PowerPoint Slides to Aid Learning with Forensic DNA Typing Book

FBI’s CODIS DNA Database Combined DNA Index System Launched October Links to all 50 states. Used for linking serial crimes and unsolved cases to.

DNA basics DNA is a molecule located in the nucleus of a cell Every cell in an organism contains the same DNA Characteristics of DNA varies between individuals.

Crime Scene Investigation Science in Motion Cedar Crest College.

DNA Profiling (DNA fingerprinting).

2 Historical Information w James Watson and Francis Crick discovered the configuration of the DNA molecule w Ray White describes first polymorphic.

Historical Information

DNA in the Cell chromosome cell nucleus Double stranded DNA molecule Individual nucleotides PCR, stands for? Polymerase Chain Reaction.what is it? Invented.

DNA Criminalist and Court Appearance

Chapter 5 Biochemical Forensic Analysis: DNA Prof. J. T. Spencer Adjunct Prof. T. L. Meeks.

Forensic DNA Analysis (Part II). Summary What is DNA? Where is DNA found in the body? How does DNA differ among individuals? Forensic DNA Analysis DNA.

Due today: Your article on what you will give your talk and research paper Plus general review article plus textbook/web page(s) ½ pg write-up Announcements:

Crime Scene Investigator PCR Basics™

CODIS – Combined DNA Index System. CODIS STRs and Probability STRAfrican American American Caucasian D VWA FGA TH

Forensic DNA: Use, Abuse, Promise, and Peril

23 4. Agenda: 4/28 Objective: To determine how DNA is used in forensic cases Human Genome – how people differ DNA Uses and Sources DNA Fingerprinting.

JS 190- Introduction to STRs I.Pre class activities a.Review Assignments and Schedules b.Exam 2 moved to Weds 11 April II. Learning Objectives a.Short.

Commonly Used Short Tandem Repeat Markers

Chapter 7 Forensic Issues: Degraded DNA, PCR Inhibition, Contamination, and Mixed Samples ©2002 Academic Press.

1 DNA Polymorphisms: DNA markers a useful tool in biotechnology Any section of DNA that varies among individuals in a population, “many forms”. Examples.

Forensic DNA Analysis Yuzhen Gao University of Soochow University

Chapter 11 Kendall/Hunt Publishing Company0 DNA Introduction (Continued)

Statistical Analysis of DNA Simple Repeats –Identical length and sequence agat agat agat agat agat Compound Repeats –Two or more adjacent simple repeats.

Advantages of STR Analysis

DNA Identification Where does DNA come from? What is it?

Forensic DNA: Use, Abuse, Promise, and Peril William M. Shields.

2 Historical Information w James Watson and Francis Crick discovered the configuration of the DNA molecule w Ray White describes first polymorphic.

9-1 PRENTICE HALL ©2008 Pearson Education, Inc. Upper Saddle River, NJ FORENSIC SCIENCE An Introduction By Richard Saferstein Chapter 9.

DNA Analysis We will learn:

Instructors Stan Hitomi Coordinator – Math & Science San Ramon Valley Unified School District Danville, CA Kirk Brown Lead Instructor, Edward Teller Education.

Crime Scene Investigator PCR Basics™

PCR Y.Martinez, LSHS, 2014 DIRECTIONS: COPY NOTES IN ORANGE.

All rights Reserved Cengage/NGL/South-Western © 2016.

Chapter 10 Advanced Concepts in DNA © 2012 Cengage Learning. All Rights Reserved.

Polymerase Chain Reaction (PCR). What’s the point of PCR? PCR, or the polymerase chain reaction, makes copies of a specific piece of DNA PCR allows you.

 Types of STR markers- 5 types based on sequence  STR allele nomenclature  Allelic ladder  Serological methods of identity profiling  Identity profiling.

 ABO blood typing  Lacks power of discrimination  RFLP analysis using minisatellite probes  High power of discrimination  Laborious  STR analysis.

DNA Forensics 352 – O’Dette. Why DNA? DNA is individual evidence DNA links or eliminates a suspect to a crime DNA identifies a victim even if no body.

DNA Fingerprinting Review. Why DNA? DNA is individual evidence DNA links or eliminates a suspect to a crime DNA identifies a victim even if no body is.

Three generations of DNA testing

POLYMERASE CHAIN REACTION

Statistical Analysis of DNA

All rights Reserved Cengage/NGL/South-Western © 2016.

All rights Reserved Cengage/NGL/South-Western © 2016.

DNA Fingerprinting Pawson, PVMHS, 2015.

The Indispensible Forensic Science Tool

DNA Fingerprinting DNA Profiling.

Chris Leibig February 1, 2018 Charles County Public Defender

Forensic DNA Analysis (Part I)

DNA Three billion base pairs in DNA 99.5% similarity among individuals

Forensic DNA Analysis.

Ch. 11: DNA Analysis.

Genotyping Results Each person was typed for 3 unlinked Short Tandem Repeat loci (STR) vWFII – chromosome 12, intron 40 of the vWF gene UT 2203 – chromosome.

DNA Analysis “The capacity to blunder slightly is the

Badger Connect Inaugural Research Services Fair Workshop

Presentation transcript:

Human Identity Testing Purpose: Match a person to a DNA sample. Examples: Paternity Test Genetic History Historical (Thomas Jefferson, Sally Hemings) Genealogical Forensic Missing Persons Identifying body parts

Forensic DNA Source: Any biological material containing cells Examples: Blood Hair (must have root) Bone / teeth Saliva Urine Semen Vaginal secretions Futuristic: discarded epidermal cells

CODIS (Combined DNA Index System) Factoids: 1990: pilot launched by FBI 1994: DNA Identification Act passed (authorized FBI to implement a national forensic data base) 1998: became operational 2000: added missing persons Purpose: Allow participating laboratories to exchange and compare profiles at a national level in electronic form.

CSF1PO D5S818 D21S11 TH01 TPOX D13S317 D7S820 D16S539D18S51 D8S1179 D3S1358 FGA VWA AMEL CODIS: 13 STR Loci and AMEL

STR (Short Tandem Repeat) TCATTCATTCATTCATTCATTCAT TCATTCATTCATTCATTCATTCATTCAT TCATTCATTCATTCATTCATTCATTCATTCAT TH01: TCAT repeat in the first intron of the tyrosine hydroxylase gene

STR Allele Frequencies Caucasians (N=427) Blacks (N=414) Hispanics (N=414) TH01 Marker * Proc. Int. Sym. Hum. ID (Promega) 1997, p. 34 Number of repeats Frequency

Reference Moe: 7/9 Larry: 9.3/9.3 Curly: 6/9 Genotyping at the TH01 Locus:

Moe: 7/9 Larry: 9.3/9.3 Curly: 6/9 Crime Scene DNA

AMEL (amelogenin locus) quick, inexpensive sex determination AMEL gene on X chromosome has 6 fewer base pairs than the gene on the Y chromosome XX give one “short” peak XY give two peaks, one “short” and one “long”

amelogenin D19 D3 D8 TH01 VWA D21 FGA D16 D18D2 amelogenin D19 D3 D8 TH01 VWA D21 FGA D16 D18 D2 Human Identity Testing with Multiplex STRs Simultaneous Analysis of 10 STRs and Gender ID AmpFlSTR ® SGM Plus™ kit first person second person