Protein Synthesis Making Proteins

Review of DNA You have 46 chromosomes. All those chromosomes are made of DNA. What is DNA?

Review of DNA DNA is a double helix. Made up of 3 structures. Phosphate Sugar Nitrogen Bases A, T, C, G

Review of DNA DNA IS THE CODE FOR LIFE! DNA is passed on from generation to generation. MEIOSIS DNA is copied when our bodies need to heal. HOW DOES IT DO THIS?

Bodies  Cells  DNA Bodies are made up of cells All cells run on a set of instructions spelled out in DNA

DNA  Cells  Bodies How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA

DNA  Proteins  Cells  Bodies DNA has the information to build proteins genes proteins cells DNA gets all the glory, Proteins do all the work bodies

How do proteins do all the work proteins run living organisms enzymes control all chemical reactions in living organisms structure all living organisms are built out of proteins

Cell organization DNA DNA is in the nucleus genes = instructions for making proteins want to keep it there = protected “locked in the vault” cytoplasm nucleus

Cell organization Proteins chains of amino acids made by a “protein factory” in cytoplasm protein factory = ribosome cytoplasm nucleus build proteins ribosome

Passing on DNA information Need to get DNA gene information from nucleus to cytoplasm need a copy of DNA messenger RNA cytoplasm nucleus build proteins mRNA ribosome

From nucleus to cytoplasm transcription DNA mRNA protein translation trait nucleus cytoplasm

DNA vs. RNA DNA RNA deoxyribose sugar nitrogen bases double stranded G, C, A, T T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded

Transcription Transcription - Making mRNA from DNA DNA strand is the template (pattern) match bases U : A G : C Enzyme RNA polymerase

Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands C U G A G U G U C U G C A A C U A A G C RNA polymerase U A G A C C T G G T A C A G C T A G T C A T C G T A C C G T

Matching bases of DNA & RNA U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA ribosome U C A G

Because the RNA leaves to go outside the nucleus, we call it mRNA, or MESSENGER RNA cytoplasm protein nucleus ribosome U C A G trait

How does mRNA code for proteins mRNA leaves nucleus mRNA goes to ribosomes in cytoplasm Proteins built from instructions on mRNA How? mRNA U C A G aa

How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA ribosome AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein aa How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)?

mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA ribosome codon AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA ? Met Arg Val Asn Ala Cys Ala protein Codon = block of 3 mRNA bases

The mRNA code There are only 20 amino acids These amino acids code for ALL life! strongest support for a common origin for all life Code has duplicates several codons for each amino acid mutation insurance! Strong evidence for a single origin in evolutionary theory. amino acid protein – made of 4 amino acids

The mRNA code Start codon – code that starts the protein making AUG methionine Stop codons – code that ends protein making UGA, UAA, UAG Strong evidence for a single origin in evolutionary theory. 24

How are the codons matched to amino acids? Transfer RNA, or tRNA – brings the amino acid to the ribosome On the amino acid is an anticodon Anti-codon – block of 3 tRNA bases 25

How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon UAC Met GCA Arg tRNA CAU Val anti-codon amino acid Anti-codon = block of 3 tRNA bases

Translation aa aa aa aa Translation – when mRNA makes the protein The working instructions  mRNA The reader  ribosome The transporter  transfer RNA (tRNA) ribosome mRNA U C A G aa tRNA G U aa tRNA U A C aa tRNA G A C tRNA aa A G U

DNA mRNA protein trait From gene to protein tRNA transcription aa transcription translation DNA mRNA protein ribosome U C A G tRNA aa trait nucleus cytoplasm

cytoplasm protein transcription translation nucleus trait

From gene to protein protein transcription translation

Interactive http://www.wisc-online.com/Objects/ViewObject.aspx?ID=AP1302

Interactive http://www.learnerstv.com/animation/biology/Proteinsynthesis.swf

Whoops! See what happens when your genes don’t work right! Any Questions?? 2009-2010