Chapter 12 Gene Expression Unlocking the secrets of DNA.

Slides:

Advertisements

Similar presentations

Chapter 10 How proteins are made.

Advertisements

RNA and PROTEIN SYNTHESIS

How is RNA different from DNA? RNA (Ribonucleic Acid)

RNA and Protein Synthesis

RNA and Protein Synthesis

What organic molecule is DNA? Nucleic Acid. An organic molecule containing hydrogen, oxygen, nitrogen, carbon, and phosphorus Examples: DNA ???? RNA.

RNA Ribonucleic Acid.

The Structure of RNA RiboNucleic Acid

How Proteins are Made. I. Decoding the Information in DNA A. Gene – sequence of DNA nucleotides within section of a chromosome that contain instructions.

Protein Synthesis (Transcription and Translation).

Ribonucleic Acid (RNA) & Protein Synthesis Ms. Napolitano & Mrs. Haas CP biology.

Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.

RNA & Protein Synthesis Chapter 13. DNA A book of instructions that tells each individual what proteins to make for their needs. The path from genes to.

Protein Synthesis Transcription and Translation. The Central Dogma The information encoded with the DNA nucleotide sequence of a double helix is transferred.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

RNA and Protein Synthesis

RNA AND PROTEIN SYNTHESIS RNA vs DNA RNADNA 1. 5 – Carbon sugar (ribose) 5 – Carbon sugar (deoxyribose) 2. Phosphate group Phosphate group 3. Nitrogenous.

Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis

RNA and Protein Synthesis

End Show Slide 1 of 39 Copyright Pearson Prentice Hall 12-3 RNA and Protein Synthesis RNA and Protein Synthesis.

RNA Ribonucleic Acid. Structure of RNA  Single stranded  Ribose Sugar  5 carbon sugar  Phosphate group  Adenine, Uracil, Cytosine, Guanine.

RNA & Protein Synthesis.

Protein Synthesis: DNA CONTAINS THE GENETIC INFORMATION TO PRODUCE PROTEINS BUT MUST FIRST BE CONVERTED TO RND TO DO SO.

From Gene To Protein Chapter 17. From Gene to Protein The “Central Dogma of Molecular Biology” is DNA  RNA  protein Meaning that our DNA codes our RNA.

Transcription & Translation Chapter 17 (in brief) Biology – Campbell Reece.

Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.

RNA and Protein Synthesis. Write these terms in your journal Ribosome — makes proteins Ribosome — makes proteins RNA polymerase — enzyme that puts together.

DNA: genes on chromosomes DNA is composed of nucleotides A Nucleotide has: - Deoxyribose Sugar - Phosphate - Nitrogen Base Adenine Thymine Guanine Cytosine.

RNA and Protein Synthesis

12-3 RNA and Protein Synthesis

PROTEIN SYNTHESIS The Blueprint of Life: From DNA to Protein.

Sections 3-4. Structure of RNA Made of nuleotides Three differences between DNA & RNA Sugar DNA = deoxyribose sugar RNA = ribose sugar RNA is single stranded.

RNA AND PROTEIN SYNTHESIS

What is central dogma? From DNA to Protein

Structure of DNA DNA is made up of a long chain of nucleotides

CHAPTER 13 RNA and Protein Synthesis. Differences between DNA and RNA  Sugar = Deoxyribose  Double stranded  Bases  Cytosine  Guanine  Adenine 

PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.

Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.

DNA, RNA. Genes A segment of a chromosome that codes for a protein. –Genes are composed of DNA.

1 RNA and Protein Synthesis. 2 The Function of DNA The DNA molecule contains all of your hereditary information in the form of genes. Genes are portions.

RNA and Protein Synthesis. RNA Structure n Like DNA- Nucleic acid- composed of a long chain of nucleotides (5-carbon sugar + phosphate group + 4 different.

CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

Ch. 11: DNA Replication, Transcription, & Translation Mrs. Geist Biology, Fall Swansboro High School.

Protein Synthesis The formation of proteins based on information in DNA and carried out by RNA. (Gene expression) Flow of Genetic Information: DNA “unzips”

RNA and Protein Synthesis

Transcription: DNA  mRNA

Molecular Biology DNA Expression

Chapter 12 DNA and RNA.

Protein Synthesis.

Chapter 13: Protein Synthesis

Protein Synthesis.

Transcription and Translation

DNA and Genes Chapter 11.

PROTEIN SYNTHESIS.

How Proteins are Made.

Chapter 12 DNA and RNA.

CHAPTER 12 Review.

RNA and Protein Synthesis

RNA and Transcription DNA RNA PROTEIN.

Nucleic Acids: RNA Ribonucleic Acid: RNA

Central Dogma Central Dogma categorized by: DNA Replication Transcription Translation From that, we find the flow of.

13.1: RNA & Transcription.

Transcription/ Translation Notes 16-17

Protein Synthesis Section 3 Transcription and Translation

Chapter 14: Protein Synthesis

Protein Synthesis.

DNA, RNA, and Mutations Study guide review.

Presentation transcript:

Chapter 12 Gene Expression Unlocking the secrets of DNA

DNA is difficult to understand, even for the cell. The nucleotide sequence of DNA is the blueprint for building proteins, but the ribosomes responsible for making proteins cannot “read” DNA.

Ribonucleic Acid 1) Messenger RNA –Single strand, complimentary copy of DNA created in nucleus; contains triplet codons 2) Transfer RNA –Cloverleaf-shaped strand that picks up amino acids and delivers them to the ribosome; contains triplet anti-codons 3) Ribosomal RNA –Makes up ribosomes; joins amino acids together to create a growing protein chain

RNA vs DNA RNA is single instead of double strand RNA has different sugar (ribose) RNA has uracil which takes the place of thymine RNA moves out of nucleus & controls protein synthesis

RNA DNA RNA polymerase Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only) Transcription: the production of RNA from the DNA code

Protein Synthesis 1. Transcription –Occurs in nucleus –DNA makes a complimentary copy in the form of M-RNA in a process similar to replication –M-RNA moves out of nucleus and to ribosomes in the cytoplasm

Transcription

Benefits of transcription Transcribed copies of the DNA (in the form of RNA) are used instead of the original DNA. In eukaryotes, DNA in the cytoplasm is degraded but RNA is not.

How does transcription work? 1.DNA double helix must be separated at the hydrogen bonds between nitrogen bases. 2.Only one DNA strand is “read” by RNA polymerase. 3.RNA polymerase constructs an RNA polymer.

Building RNA polymer DNA  (codes for) RNA A  U T  A C  G G  C

Click on image to play video.

What happens to the RNA once it is created? In prokaryotes, the RNA is immediately translated. In eukaryotes, the RNA is processed. –Introns removed –Exons joined together

RNA processing Introns (segments of useless genes) are removed, leaving on exons (expressed genes).

2. Translation –Occurs in cytoplasm –T-RNA delivers amino acids to ribosomes & joins complimentary anticodons, putting amino acids in proper order –R-RNA forms peptide bonds to join amino acids into a protein molecule –(T-RNA returns to pick up new amino acids)

Translation

Ribosomes use this decoding scheme to determine how to build the appropriate protein.

How does the decoding work? RNA: AUGCGAGGGAGAUUAUAGGAC Ribosomes read AUG – CGA – GGG – AGA – UUA – UAG – GAC. Each 3 nucleotide “word” is called a codon.

Try to decode AUG CGA GGG AGA UUA UAG GAC. Met – Arg – Gly – Arg – Leu - stop

What happens to Met–Arg–Gly–Arg–Leu–stop? The ribosomes create an amino acid polymer that is folded into a protein. The original DNA code, transcribed to RNA, instructs the cell to make a protein for a specific function.

Click on image to play video.

What happens if there is a mutation in the original DNA? Point mutations: change of one nucleotide sequence This may or may not affect the amino acid sequence, depending upon where the mutation occurs in the DNA sequence.

Gene mutations Point mutations –Change one nucleotide or just a few nucleotides in a gene –Examples: sickle cell anemia & cystic fibrosis Frame-shift mutations –The reading pattern is displaced and “shifts” into new positions –Examples: duchenne Muscular Dystrophy

Frame shift mutations The cat and the rat ran far. The ca and the rat ran far. tr

Click on image to play video.

Mutations Disadvantages: –Abnormal, even lethal genes can be passed on to offspring Advantages: –New, stronger genes can be passed on to offspring

Chromosomal mutations Deletion = Insertion = Inversion = Translocation = A B C D E F G H A B C D E G H A B C D J E F G H A B C D E G F H G H W X Y Z A B C D E F

DNA 5’ A T G C C T G A A T G A 3’ 3’ T A C G G A C T T A C T 5’ coding strand mRNA A UG C C U G A A U G A codons tRNA U A C G G A C U U A C U anti codons amino acids Met Pro Glu stop protein

The Central Dogma theory of Biology (DNA RNA protein cell functions)

Animation of translation Click to automatically start animation.

Single Messenger RNA Strand This is a ribosome.

Met Single Messenger RNA Strand

Met Single Messenger RNA Strand Arg

Met Single Messenger RNA Strand Arg

Met Single Messenger RNA Strand Arg

Met Single Messenger RNA Strand Arg

Met Single Messenger RNA Strand Arg

Met Single Messenger RNA Strand Arg

Met Single Messenger RNA Strand Arg

Met Single Messenger RNA Strand Arg

Met Single Messenger RNA Strand Arg

Single Messenger RNA Strand Met Arg

Single Messenger RNA Strand Met Arg

Single Messenger RNA Strand Met Arg

Single Messenger RNA Strand Met Arg

Single Messenger RNA Strand Met Arg

Single Messenger RNA Strand MetArgGly

Single Messenger RNA Strand MetArgGly

Single Messenger RNA Strand Met Arg Gly

Single Messenger RNA Strand Met Arg Gly

Single Messenger RNA Strand MetArgGly

Single Messenger RNA Strand MetArgGly

Single Messenger RNA Strand MetArgGly

Single Messenger RNA Strand MetArgGly

Single Messenger RNA Strand MetArgGly

Single Messenger RNA Strand MetArgGly

Single Messenger RNA Strand MetArgGly

Single Messenger RNA Strand Met Arg Gly

Single Messenger RNA Strand Met Arg Gly

Single Messenger RNA Strand Met Arg Gly

Single Messenger RNA Strand Met Arg Gly

Single Messenger RNA Strand Met Arg Gly

Single Messenger RNA Strand Met Arg Gly

Single Messenger RNA Strand Met Arg Gly

Single Messenger RNA Strand Met Arg Gly Lys

Single Messenger RNA Strand Met Arg Gly Lys

Single Messenger RNA Strand Met Arg Gly Lys

Single Messenger RNA Strand Met Arg Gly Lys

Single Messenger RNA Strand Met Arg Gly Lys

Single Messenger RNA Strand Met Arg Gly Lys

Single Messenger RNA Strand Met Arg Gly Lys

Single Messenger RNA Strand Met Arg Gly Lys

Single Messenger RNA Strand Met Arg Gly Lys

Single Messenger RNA Strand Met Arg Gly Lys

Single Messenger RNA Strand Met Arg Gly Lys

Single Messenger RNA Strand Met Arg Gly Lys

Single Messenger RNA Strand Met Arg Gly Lys

Single Messenger RNA Strand Met Arg Gly Lys

Single Messenger RNA Strand Met Arg Gly Lys

Met Arg Gly Lys

Met Arg Gly Lys

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArgGlyLysStop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

MetArg Gly Lys Stop

Protein Synthesis overview

Transcription: DNA codes for RNA RNA polymerase A  U T  A C  G G  C

mRNA processing The RNA polymer made = messenger RNA (mRNA) DNA has “junk” genes. These are called introns (useless pieces of RNA made as a result of useless DNA). Introns are cut (“spliced”). Exons are remaining RNA nucleotides carrying the actual DNA code. Exons are translated.

Translation: RNA to amino acids Ribosomes “read” codons. AUG = start codon tRNA with anticodons have amino acids attached.

Translation Ribosomes read until the codon that indicates STOP.

Amino acid chain The amino acid chain made in translation is then folded. Folded proteins = enzymes, pigments, etc. Proteins made = phenotype