BELL WORK: On your “Models: Transcription and Translation” packet from yesterday, answer questions 1-4 on the second page. You may work with your neighbor.

Slides:

Advertisements

Similar presentations

RNA and Protein Synthesis

Advertisements

CH 11.4 & 11.5 “DNA to Polypeptide”.

RNA and Protein Synthesis

Transcription & Translation Biology 6(C). Learning Objectives Describe how DNA is used to make protein Explain process of transcription Explain process.

RNA and Protein Synthesis

RNA & Protein Synthesis

RNA and Protein Synthesis

10-2: RNA and 10-3: Protein Synthesis

Protein Synthesis Chapter 11.

Lesson Overview 13.1 RNA.

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

Q2 WK8 D3 & 4. How does DNA’s message travel OUT of the nucleus and INTO THE CELL, where the message gets expressed as a protein??? This is known as…

VII RNA and Protein Synthesis

DNA, RNA, and Protein Synthesis

Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis

Transcription and Translation. What is Transcription? It is a process that produces a complementary strand of RNA by copying a complementary strand of.

THE MOST IMPORTANT BIOLOGY LESSON OF THE YEAR How does DNA work?

The Genetic Code.

 DNA is the blueprint for life – it contains your genetic information  The order of the bases in a segment of DNA (__________) codes for a particular.

RNA and Protein Synthesis

Bellwork Copy and complete the following Venn Diagram ReplicationTranscription.

 DNA is the blueprint for life – it contains your genetic information  The order of the bases in a segment of DNA (GENE) codes for a particular protein;

Protein Synthesis The process of putting together amino acids to form proteins in the cell. The process of putting together amino acids to form proteins.

12-3 RNA AND PROTEIN SYNTHESIS. 1. THE STRUCTURE OF RNA.

1. 4. Ribosome Translation 3. Protein 2. BELL WORK ( Buff Binder – start a new sheet !): Fill in the blanks on the diagram below: DNAmRNA Transcription.

DNA Transcription & Protein Translation. Today’s Objectives Introduce Protein Synthesis Compare types of nucleic acid.

Bellwork Copy and complete the following Venn Diagram ReplicationTranscription.

DNA Transcription & Protein Translation. DNA Transcription DNA must be copied to messenger RNA (mRNA) in the nucleus mRNA travels from nucleus to the.

RNA & Protein Synthesis. RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins within the cell DNA codes.

HAPPY FRIDAY Bellwork:

Objective: to understand RNA and transcription and translation 12.3.

Decoding the message. DNA and RNA work together to produce proteins Remember: A protein is a specific sequence of amino acids.

Structure of DNA DNA is made up of a long chain of nucleotides

Central Dogma DNA Nucleus Ribosome Translation Transcription Protein RNA HAPPY TUESDAY Fill in the blanks

YouTube - "The Gene Scene". The Structure of RNA There are three main differences between RNA and DNA. 1. The sugar in RNA is ribose instead of deoxyribose.

RNA & Protein Synthesis. RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins within the cell DNA codes.

PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.

Hey Hey it’s Wednesday! 10/21

8.4 Transcription KEY CONCEPT Transcription converts a gene into a single-stranded RNA molecule.

RNA and Protein Synthesis Chapter How are proteins made? In molecular terms, genes are coded DNA instructions that control the production of.

Chapter 13 – RNA & Protein Synthesis MS. LUACES HONORS BIOLOGY.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

CH 12.3 RNA & Protein Synthesis. Genes are coded DNA instructions that control the production of proteins within the cell…

RNA and Transcription. Genes Genes are coded DNA instructions that control the production of proteins within the cell To decode the genetic message, you.

Genetics: RNA and Protein Synthesis

Notes: Transcription DNA vs. RNA

Day 08 Warm Up- You and your partner will discuss DNA replication vs transcription after watching the 2 videos DNA Replication Transcription/Translation.

CH 12.3 RNA & Protein Synthesis.

Translation mRNA  protein.

HAPPY MONDAY  Bellwork: Number a piece of paper 1 – 20.

PROTEIN SYNTHESIS CHAPTER 10 section 4

Protein Synthesis From genes to proteins.

12-3 RNA and Protein Synthesis

Protein Synthesis Standards:

RNA and Protein Synthesis

RNA Ribonucleic Acid.

12-3 RNA and Protein Synthesis

Protein Synthesis Standards:

Protein Synthesis.

HAPPY MONDAY  Bellwork: Number a piece of paper 1 – 20.

12-3 RNA and Protein Synthesis

Comparing RNA and DNA Each nucleotide in both DNA and RNA is made up of a 5-carbon sugar, a phosphate group, and a nitrogenous base. There are three important.

Notes: RNA (pg. 5) RNA – Ribonucleic Acid

Translation Decoding the message.

Transcription/ Translation Notes 16-17

Transcription and Translation

RNA, Protein Synthesis, Transcription, and Translation

DNA Transcription and Translation

Do Now Describe the three types of RNA.

3 July 2019 P. 56 Complete Quick Lab p. 303 Compare and contrast:

Presentation transcript:

BELL WORK: On your “Models: Transcription and Translation” packet from yesterday, answer questions 1-4 on the second page. You may work with your neighbor if you wish.

1.Name three differences between DNA and RNA. 2.Draw and label one RNA nucleotide. 3.Where does Transcription occur in the cell? 1.RNA has ribose instead of deoxyribose 2.RNA is single-stranded 3.RNA has Uracil instead of Thymine In the nucleus!

Science Fact of the Day The largest octopus is the Enteroctopus dofleini, also known as the giant Pacific octopus or North Pacific giant octopus. It has a 16 ft arm span and weighs about 110 pounds. As requested by Victoria Westbrook

CO: I will understand and explain the process and purpose of translation. LO: I will write notes about translation. I will play a BINGO using a codon chart.

Central Dogma DNA Nucleus Ribosome Translation Transcription Protein RNA Copy and label the:

Transcription Review and Translation Intro.

Remember our analogy from yesterday…. DNA = master copy of building plans RNA= blueprint for one room of building Protein= actual bricks that make up the building Nucleus = boss’ office Ribosome = assembly line (where the bricks are laid and a wall is built)

The decoding of an mRNA message into a polypeptide chain is known as translation. Proteins are assembled on a ribosome – OUTSIDE of the nucleus (in the cytoplasm)

Steps of Translation (Overview) 1.mRNA travels to the ribosome 2.Transfer RNA (tRNA) brings the right amino acid to the ribosome 3.A polypeptide (protein) is formed

How does tRNA “know” what amino acid to bring?

The genetic code (mRNA) is read three bases at a time. Each three-letter “word” is known as a codon. tRNA “looks” for the codon that pairs with its 3 nucleotide sequence (called an anticodon). When it connects the ribosome attaches the amino acid that tRNA was carrying to the polypeptide chain

ORDER MATTERS! Order of DNA bases  order of RNA bases  order of amino acids  what protein is made tRNA mRNA Amino acid

How to use the Codon Chart: 1.Use the left side to find the first letter in the codon 2.Use the top to find the second letter in the codon 3.Use the right side to find the third letter of the codon 4.Go to where ALL three overlap on the chart

How to use the Codon Wheel: 1.Begin in the middle with the first letter of the codon 2.Go outward to the second letter in the codon 3.Go outward again to the third letter in the codon.

Did you notice?: The codon “AUG” can specify methionine or serve as the “start” codon for protein synthesis.

What codon will tell the ribosome to quit putting amino acids together? What letters code for this?

Codon Bingo! Directions For Playing: If a codon (example: AAG) is called out, you must find the amino acid. If an amino acid (example: serine) is called out, you must find the codon. Hint! When finding a codon, there may be more than one answer…you can count all possible answers on your card!