Protein synthesis. Why protein synthesis Proteins do almost all of the work in the cell (and organism). Six functions of proteins Control of the number.

Slides:

Advertisements

Similar presentations

RNA and Protein Synthesis

Advertisements

Do Now:.  TRANSCRIPTION: process that makes an RNA copy of DNA.  RNA is single-stranded, and T is replaced by U (A-U; G-C)  RNA polymerase makes RNA,

Central Dogma Big Idea 3: Living systems store, retrieve, transmit, and respond to info essential to life processes.

Cell Division, Genetics, Molecular Biology

End Show Slide 1 of 39 Copyright Pearson Prentice Hall Biology Protein Synthesis: I will understand the general pathway of transcription and translation.

Chapter 13: RNA and Protein Synthesis

Cell Protein Production

Protein Synthesis.

PROTEIN SYNTHESIS.

TRNA. Transfer RNA (tRNA) is a small molecule, existing as a single- strand that is folded into a clover-leaf shape.

FROM GENE TO PROTEIN: TRANSCRIPTION & RNA PROCESSING Chapter 17.

Protein Synthesis: Transcription

13.1/13.2 Protein Synthesis From DNA to Protein Protein Synthesis is the process that cells use to produce - it involves.

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.

Transcription and Translation

Gene Expression. What is Gene Expression?  Expression can be defined as: –Shown –Manifested –Articulated We can determine a person’s genes by what is.

Protein Synthesis. DNA acts like an "instruction manual“ – it provides all the information needed to function the actual work of translating the information.

Protein Synthesis. The DNA Code It is a universal code. The order of bases along the DNA strand codes for the order in which amino acids are chemically.

VII RNA and Protein Synthesis

RNA and Protein Synthesis

Part Transcription 1 Transcription 2 Translation.

What is the job of p53? What does a cell need to build p53? Or any other protein?

Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.

Central Dogma DNA  RNA  Protein. …..Which leads to  Traits.

RNA and Protein Synthesis

Protein Synthesis Process that makes proteins

Transcription & Translation Transcription DNA is used to make a single strand of RNA that is complementary to the DNA base pairs. The enzyme used is.

Replication Transcription Translation

12-3 RNA and Protein Synthesis

Protein Synthesis The process of putting together amino acids to form proteins in the cell. The process of putting together amino acids to form proteins.

1 PROTEIN SYNTHESIS. DNA and Genes 2 Genes & Proteins DNA contains genes, sequences of nucleotide bases These genes code for polypeptides (proteins)

Sections 3-4. Structure of RNA Made of nuleotides Three differences between DNA & RNA Sugar DNA = deoxyribose sugar RNA = ribose sugar RNA is single stranded.

Pharmaceutical Biotechnology. Protein Synthesis Recombinant DNA Technology.

Protein Synthesis Transcription and Translation. Protein Synthesis: Transcription Transcription is divided into 3 processes: –Initiation, Elongation and.

DNA Transcription & Protein Translation. DNA Transcription DNA must be copied to messenger RNA (mRNA) in the nucleus mRNA travels from nucleus to the.

Molecular Genetics Protein Synthesis Overview. The Central Dogma DNA contains the blueprint for protein synthesis, but proteins are synthesized outside.

DNA, RNA, and Protein Replication Transcription Translation.

Protein Synthesis AS Biology. Protein synthesis pg DNA unwinds 2. mRNA copy is made of one of the DNA strands. 3. mRNA copy moves out of nucleus.

RNA & Protein Synthesis Ribose RNA. DNARNA StructureDouble Stranded Single Stranded Bases- PurinesAdenine (A) Guanine (G) Bases - Pyrimidines Cytosine.

Do Now: On the “Modeling DNA” handout, determine the complimentary DNA sequence and the mRNA sequence by using the sequence given.

Protein Synthesis Traits are determined by proteins (often enzymes) *Protein – 1 or more polypeptide chains *Polypeptide – chain of amino acids linked.

RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.

Chapter 13 GENE FUNCTION. A. Comparison of DNA & RNA.

Copy this DNA strand. DNA: ATGCCGCACTCTGGGTCGACT …AND WRITE THE COMPLEMENT.

Transcription and Translation Chapter 21. Objectives Summarize how genetic information is encoded in DNA, how it provides instructions for making proteins.

12-3 RNA and Protein Synthesis Page 300. A. Introduction 1. Chromosomes are a threadlike structure of nucleic acids and protein found in the nucleus of.

Protein Synthesis Who am I? How was I formed? Where’s my mom? A molecular model of the YiiP zinc transporter protein with bound zinc ions (red spheres).

Gene Expression : Transcription and Translation 3.4 & 7.3.

Chapter – 10 Part II Molecular Biology of the Gene - Genetic Transcription and Translation.

DNA to RNA to Protein. RNA Made up of 1. Phosphate 2. Ribose (a sugar) 3. Four bases RNA bases are: Adenine Guanine Cytosine Uracil (instead of thymine)

Transcription, RNA Processing, & Translation

RNA and Protein Synthesis

Protein synthesis DNA is the genetic code for all life. DNA literally holds the instructions that make all life possible. Even so, DNA does not directly.

Transcription, RNA Processing, & Translation

Transcription Part of the message encoded within the sequence of bases in DNA must be transcribed into a sequence of bases in RNA before translation can.

RNA, & Protein Synthesis

Protein Synthesis Ch 17.

Protein Synthesis.

Gene Expression : Transcription and Translation

Chp: 12 Transcription & Translation

Transcription & Translation.

HOW PROTEINS ARE MADE BY THE CELL

Cell Protein Production

copyright cmassengale

RNA - TRANSLATION.

Ribosomes and Protein Synthesis

GENE EXPRESSION / PROTEIN SYNTHESIS

Translation AKA, Protein Synthesis Amino Acid Protein tRNA Nucleus

copyright cmassengale

Presentation transcript:

Protein synthesis

Why protein synthesis Proteins do almost all of the work in the cell (and organism). Six functions of proteins Control of the number and type of proteins is critical for maintaining homeostasis. Understanding protein synthesis allows us to understand the most important homeostatic control system.

scale Nerve cells rarely undergo mitosis, but require a large number of transport proteins to be produced. You produce about 1,000,000 red blood cells per minute, each cell is stuffed full of hemoglobin proteins. Beta cells in the pancreas have to produce insulin in large amounts rapidly when food/drink is taken in.

How is it controlled? What is found on chromosomes? What do genes do? How many genes do we have? How many different types of proteins are found in your body?

Transcription elongation RNA Polymerase moves along template strand. RNA Polymerase makes RNA complementary copy of template strand of DNA. DNA rewinds pushing off RNA strand

Transcription- termination RNA Polymerase reaches terminator and falls off. DNA rewinds pushing the RNA strand completely off.

Translation initiation tRNA carrying MET joins with mRNA and small ribosome subunit at AUG Large ribosome subunit joins complex.

Translation elongation 2nd tRNA brings in next amino acid. Large ribosome subunit joins amino acids. Ribosome moves over 1 codon. 1st tRNA falls off. Next tRNA comes in.

Translation- termination When ribosome reaches stop codon, a protein called release factor binds. Release factor breaks up complex, releasing polypeptide.

RNA processing

Occurs after transcription, before the mRNA leaves the nucleus. Proteins cut out the introns and put the exons back together. Exons can be rearranged to produce different proteins from the same gene.

RNA processing How does the mRNA know where to go? ◦ Proteins add a cap to the beginning of the mRNA. ◦ Cap tells whether mRNA goes to free ribosome in cytoplasm or Rough ER How many proteins can be made from 1 mRNA strand? ◦ Proteins add a tail to the mRNA, the longer the tail, the more proteins can be made from it.

mutations

Genetic code chart