Genetic Mutations Frame-shift and point mutations.

Slides:

Advertisements

Similar presentations

Cancer & Mutations Powerpoint

Advertisements

SC.912.L.16.4 Explain how mutations in the DNA sequence may or may not result in phenotypic change. Explain how mutations in gametes may result in.

DNA (Gene) Mutations.

Copyright © 2006 Pearson Education, Inc., publishing as Benjamin Cummings Translation  mRNA is translated in codons (three nucleotides)  Translation.

Mutations Section 12–4 This section describes and compares gene mutations and chromosomal mutations.

Mutations. The picture shows a human genome Karyotype. Look at it carefully and discuss.

Mutations. Hollywood’s images of mutation Mutations Actual Mutations in fruit flies.

How is the amino acid sequence determined?

14.4 Gene Mutations. What is a Mutation? A mutation is any change in the amount or structure of the DNA of an organism. KEY POINT: If this occurs in somatic.

Defined: a change in an organism’s DNA Where: DNA or Chromosomes When: During replication, Synapses, or Crossing-Over Mutations can affect a single.

A mutation is a change in an organism’s DNA.

Mutations are changes in genetic material

DNA (Gene) Mutations. What is a gene mutation? Parts of DNA will have a base (or more) missing, added, or incorrect A mistake in the genetic code Wrong.

Mutations (12.4) State Standard

Mutations 3.29 Recall that mutation is a rare, random change in genetic material that can be inherited. 3.31 Understand that many mutations are harmful.

DNA, Mutations and Hazardous Waste. Prokaryote Cell.

1. What are genetic disorders caused by. 2

Genetic Mutations Increasing Genetic Diversity May 4, 2010.

What is a mutation? A mutation is any change in genetic material. There are many ways for mutations to occur. Common point mutations are...

Mutations Changes to DNA. What are Mutations? Any change to the DNA Mutations in body (somatic) cells can cause cell death or cancer Those in germ (sex)

Mutation Chapter 16. Mutation A change in structure or amount of genetic material If phenotype is altered – affected organism is called a mutant Mutation.

8.7 Mutations TEKS 6E The student is expected to: 6E identify and illustrate changes in DNA and evaluate the significance of these changes.

1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.

Introduction A mutation is a change in the normal DNA sequence. They are usually neutral, having no effect on the fitness of the organism. Sometimes,

NOTES – CH 17, part 2 DNA & MUTATIONS

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

8.7 Mutations A mutation is a change in an organism’s DNA. This may or may not affect phenotype.

Mutations Csaba Bödör, Semmelweis University, 1 st Dept. of Pathology.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

Name the 4 gene mutations that can occur State the effect of gene mutations on amino acid sequences.

Reality Science Fiction! Just silly.. 1. Some mutations affect a single gene, while others affect an entire chromosome. 2. A mutation is a change in an.

Chapter 10 Mutations Student Mutations can change the meaning of genes  A mutation is any change in the nucleotide sequence of DNA.  Mutations.

8.7 Mutations A mutation is a change in an organism’s DNA. May occur during replication. May affect a single gene, or an entire chromosome May or may not.

8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.

Gene Mutations.

A mutation is a change in an organism’s DNA.

Gene Mutations.

MUTATIONS And their effect.

Gene Mutations.

Mutations. Mutations Mutation A permanent, heritable change in the DNA of an organism. One or several nucleotides can be added, deleted, or replaced.

Types of point mutations

To be successful today…

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Some mutations affect a single gene, while others affect an entire chromosome.

A ____________ is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

DNA and the Genome Key Area 6a & b Mutations.

DNA and the Genome Key Area 6a & b Mutations.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

Mutation: Some Definitions

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Mutations Chapter 8.7

Copyright Pearson Prentice Hall

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Protein Synthesis and Mutation

Mutations: Changes in Genes

Presentation transcript:

Genetic Mutations Frame-shift and point mutations

Point mutations – substitution These only affect a small part of the gene. Substitution normal mutant g g c c t c c t c DNA g g c c a c c t c c c g g a g g a g mRNA c c g g u g g a g pro glu glu protein pro val glu Only one amino acid is affected in the primary structure.

Frame shift mutations – insertion and deletion These can affect a large part of the gene. Insertion normal mutant a g a g t c t t c DNA a g a g g t c t u c u c a g a a g mRNA u c u c c a g a a ser glu lys protein ser pro glu All the amino acids after the insertion will be affected in the primary structure of the protein.

Frame-shift mutations – insertion and deletion These can affect a large part of the gene. Deletion normal mutant a g a g t c t t c DNA a g a g c t t c g u c u c a g a a g mRNA u c u c c a g a a ser glu lys protein ser arg ser All the amino acids after the deletion will be affected in the primary structure of the protein.

(single nucleotide polymorphism) Summary Point mutation Occurs at a single point – substitution. Generally not too harmful, most of the protein remaining unaffected. Only one amino acid affected so the protein will probably be functional. (single nucleotide polymorphism)

Summary Frame-shift mutation After a deletion or insertion the open reading frame is moved one base pair forward or backward. This is generally harmful since all the amino acids in the primary structure of the protein will have changed from the mutation onwards. The protein will probably be non-functioning.

Mutation Naturally occurring mutations are rare, they occur randomly and spontaneously. Mutations can be induced by mutagenic agents such as gamma rays, X-rays and UV light. Tar in cigarettes, certain food additives and many chemicals are thought to induce mutations. Some mutagens are also carcinogens – cancer-causing mutations.

Mutation Most mutant alleles are recessive so are only seen in the phenotype when two recessive alleles are present. However, some are dominant (achondroplasia) and some are sex-linked (haemophilia). Some mutations give rise to better genes and provide alternative choices on which natural selection can act. They are considered to be the raw material of evolution.