Is DNA living? Is DNA living? In genetics we talked about how parents pass their genes onto their offspring. How do these genes (made of DNA) turn into things like hair color, eye color or genetic disorders? In genetics we talked about how parents pass their genes onto their offspring. How do these genes (made of DNA) turn into things like hair color, eye color or genetic disorders?
Answer: Protein Synthesis RNA Proteins DNA Transcription Translation
RNA (ribonucleic acid) Difference between RNA and DNA Difference between RNA and DNA Ribose instead of deoxyribose Uracil instead of thymine (U bonds to A) Single stranded Types of RNA Messenger RNA (mRNA) – transfers information from DNA to ribosome. Contains the codons. Transfer RNA (tRNA) – made of an anticodon and amino acid. There are only 20 amino acids but many tRNAs
Part 1 of Protein Synthesis: Transcription -synthesis of mRNA- 1. Only 1 strand of DNA is transcribed – RNA polymerase determines where to start by finding “promotor” base sequence on the DNA (TAC) 2. Termination is controlled by a Stop sequence
Codons Codon – a group of 3 bases on mRNA that codes for an amino acid. Example: UUA Codon – a group of 3 bases on mRNA that codes for an amino acid. Example: UUA
Take a closer look at this process 3fOXt4MrOM&feature=related 3fOXt4MrOM&feature=related
Anticodons Anticodon – group of 3 bases on a tRNA that is complementary to the codon. Example AAU Anticodon – group of 3 bases on a tRNA that is complementary to the codon. Example AAU
Part 2 of Protein Synthesis: Translation 1. mRNA is held in place by the ribosome. 2. tRNAs with the anticodon and amino acid temporarily bond to the complimentary codon of the mRNA 3. The tRNAs carry the amino acid. 4. The amino acids attach to each other making the protein.
For the following DNA strand determine the mRNA, tRNAs and the protein. gggtacagtcggtagtggattgcccccatgtcagccatcacctaacgg
gggtacagtcggtagtggattgcc mRNAaugucagccaucaccuaa tRNA uac agu cgg uag ugg auu Protein: Start-Serine-Alanine-isolucine-threonine-Stop
For the following DNA strand determine the mRNA, tRNAs and the protein. ccctacatattacgagaacacgtaactcc